<i>Drosophila</i> Smt3 negatively regulates JNK signaling through sequestering Hipk in the nucleus

Huang, Hai; Du, Guiping; Chen, Hanqing; Liang, Xuehong; Li, Changqing; Zhu, Nannan; Xue, Lei; Ma, Jun; Jiao, Renjie

doi:10.1242/dev.061770

Cited by 36 publications

(33 citation statements)

References 68 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For example, sumoylation can control the activity of c-Jun N-terminal kinase (JNK) and Janus kinase/Signal transducer and activator of transcription (JAK/STAT) pathways in Drosophila, both of which are known to be involved in the regulation of immune system homeostasis (Gronholm et al 2010;Huang et al 2011). Other pathways controlled by sumoylation, including Ras (Nie et al 2009), ecdysteroid signaling (Talamillo et al 2008b), and the IMD pathway (Fukuyama et al 2013), may also contribute to the observed effects such as systemic inflammation.…”

Section: Discussionmentioning

confidence: 99%

Regulation of Toll Signaling and Inflammation by β-Arrestin and the SUMO Protease Ulp1

Anjum

Nikkholgh

et al. 2013

Genetics

View full text Add to dashboard Cite

The Toll signaling pathway has a highly conserved function in innate immunity and is regulated by multiple factors that fine tune its activity. One such factor is b-arrestin Kurtz (Krz), which we previously implicated in the inhibition of developmental Toll signaling in the Drosophila melanogaster embryo. Another level of controlling Toll activity and immune system homeostasis is by protein sumoylation. In this study, we have uncovered a link between these two modes of regulation and show that Krz affects sumoylation via a conserved protein interaction with a SUMO protease, Ulp1. Loss of function of krz or Ulp1 in Drosophila larvae results in a similar inflammatory phenotype, which is manifested as increased lamellocyte production; melanotic mass formation; nuclear accumulation of Toll pathway transcriptional effectors, Dorsal and Dif; and expression of immunity genes, such as Drosomycin. Moreover, mutations in krz and Ulp1 show dosage-sensitive synergistic genetic interactions, suggesting that these two proteins are involved in the same pathway. Using Dorsal sumoylation as a readout, we found that altering Krz levels can affect the efficiency of SUMO deconjugation mediated by Ulp1. Our results demonstrate that b-arrestin controls Toll signaling and systemic inflammation at the level of sumoylation.

show abstract

Section: Discussionmentioning

confidence: 99%

Regulation of Toll Signaling and Inflammation by β-Arrestin and the SUMO Protease Ulp1

Anjum

Nikkholgh

et al. 2013

Genetics

View full text Add to dashboard Cite

show abstract

“…2). However, it has recently been shown that SUMOylation regulates the JNK pathway as well, through Hipk kinase (Huang et al, 2011). This suggests that the apoptosis of SUMOylation-deficient cells is probably a synergistic result of many different causes.…”

Section: Discussionmentioning

confidence: 99%

A differential requirement for SUMOylation in proliferating and non-proliferating cells during Drosophila development

Kanakousaki

Gibson

2012

Development

View full text Add to dashboard Cite

SUMMARYSUMOylation is a highly conserved post-translational modification shown to modulate target protein activity in a wide variety of cellular processes. Although the requirement for SUMO modification of specific substrates has received significant attention in vivo and in vitro, the developmental requirements for SUMOylation at the cell and tissue level remain poorly understood. Here, we show that in Drosophila melanogaster, both heterodimeric components of the SUMO E1-activating enzyme are zygotically required for mitotic progression but are dispensable for cell viability, homeostasis and DNA synthesis in non-dividing cells. Explaining the lack of more pleiotropic effects following a global block of SUMO conjugation, we further demonstrate that low levels of global substrate SUMOylation are detected in mutants lacking either or both E1 subunits. These results not only suggest that minimal SUMOylation persists in the absence of Aos1/Uba2, but also show that the process of cell division is selectively sensitive to reductions in global SUMOylation. Supporting this view, knockdown of SUMO or its E1 and E2 enzymes robustly disrupts proliferating cells in the developing eye, without any detectable effects on the development or differentiation of neighboring post-mitotic cells.

show abstract

“…Full-length Notch expression was induced by 500 µM CuSO 4 for 24 hours after pMTNotch transfection (Fehon et al, 1990). Double-stranded (ds) RNA was prepared with the RiboMAX large-scale RNA production system-T7 kit (Promega) as previously described (Huang et al, 2011). Primers (forward and reverse, 5Ј-3Ј) were: dCAF-1-p105, gatcactaatacgactcactataggg -CCGAGTCAGCAAATGTGTAC and gatcactaatacgactcactataggg -ACTGACACTGTGCGTTGATG; GFP control, ttaatacgactcactataggggaga-ATGGTGAGCAAGGGCGAGGAGCTG and ttaatacgactcactataggggaga -CTTGTACAGCTCGTCCATGCCGAGAG (lowercase letters indicate T7 promoter sequences).…”

Section: S2 Cell Culture Transfection and Rna Interference (Rnai) Asmentioning

confidence: 99%

CAF-1 promotes Notch signaling through epigenetic control of target gene expression during Drosophila development

Chen

et al. 2013

Development

Self Cite

View full text Add to dashboard Cite

SUMMARYThe histone chaperone CAF-1 is known for its role in DNA replication-coupled histone deposition. However, loss of function causes lethality only in higher multicellular organisms such as mice and flies, but not in unicellular organisms such as yeasts, suggesting that CAF-1 has other important functions than histone deposition during animal development. Emerging evidence indicates that CAF-1 also has a role in higher order chromatin organization and heterochromatin-mediated gene expression; it remains unclear whether CAF-1 has a role in specific signaling cascades to promote gene expression during development. Here, we report that knockdown of one of the subunits of Drosophila CAF-1, dCAF-1-p105 (Caf1-105), results in phenotypes that resemble those of, and are augmented synergistically by, mutations of Notch positive regulatory pathway components. Depletion of dCAF-1-p105 leads to abrogation of cut expression and to downregulation of other Notch target genes in wing imaginal discs. dCAF-1-p105 is associated with Suppressor of Hairless [Su(H)] and regulates its binding to the enhancer region of E(spl)mβ. The association of dCAF-1-p105 with Su(H) on chromatin establishes an active local chromatin status for transcription by maintaining a high level of histone H4 acetylation. In response to induced Notch activation, dCAF-1 associates with the Notch intracellular domain to activate the expression of Notch target genes in cultured S2 cells, manifesting the role of dCAF-1 in Notch signaling. Together, our results reveal a novel epigenetic function of dCAF-1 in promoting Notch pathway activity that regulates normal Drosophila development.

show abstract

Drosophila Smt3 negatively regulates JNK signaling through sequestering Hipk in the nucleus

Cited by 36 publications

References 68 publications

Regulation of Toll Signaling and Inflammation by β-Arrestin and the SUMO Protease Ulp1

Regulation of Toll Signaling and Inflammation by β-Arrestin and the SUMO Protease Ulp1

A differential requirement for SUMOylation in proliferating and non-proliferating cells during Drosophila development

CAF-1 promotes Notch signaling through epigenetic control of target gene expression during Drosophila development

Contact Info

Product

Resources

About