Desulfovibrio sp. Genes Involved in the Respiration of Sulfate during Metabolism of Hydrogen and Lactate

Abstract

To develop a better understanding of respiration by sulfate-reducing bacteria, we examined transcriptional control of respiratory genes during growth with lactate or hydrogen as an electron donor. RNA extracts of Desulfovibrio desulfuricans subsp. aestuarii were analyzed by using random arbitrarily primed PCR. RNA was reverse transcribed under low-stringency conditions with a set of random primers, and candidate cDNAs were cloned, sequenced, and characterized by BLAST analysis. Putative differentially expressed transcripts were confirmed by Northern blot analysis. Interestingly, dissimilatory bisulfite reductase was upregulated in the presence of hydrogen. To link these transcriptional changes to the physiology of sulfate-reducing bacteria, sulfide was measured during growth of several strains of Desulfovibrio on hydrogen or lactate, and this revealed that hydrogen-grown cells produced more sulfide per unit of cell mass than lactate-grown cells. Transcription of other redox proteins was characterized by Northern blotting to determine whether or not they were also transcribed to higher levels in hydrogen-grown cells. Growth on lactate produced greater transcription of [NiFe] hydrogenase. H 2 -grown cells transcribed the adenylylsulfate reductase b subunit and HmcA to higher levels. The results we describe here provide new insight into the continuing debate over how Desulfovibrio species utilize redox components to generate membrane potential and to channel electrons to sulfate, the final electron acceptor.Sulfate-reducing bacteria (SRB) are a diverse group of microorganisms found in a variety of anaerobic environments, and all members possess the ability to use sulfate as a terminal electron acceptor. SRB can use a variety of organic electron donors, including hydrogen, lactate, formate, malate, fumarate, pyruvate, alcohols, and even environmental contaminants (13). While progress has been made in understanding the biochemistry of proteins involved in respiratory processes, to date little is known about how such proteins are utilized by the SRB to gain energy for cell growth.For years, a debate over the mechanism by which lactate is oxidized in SRB has existed. In 1981, Odom and Peck proposed the hydrogen-cycling model for growth on lactate (12). In this model, electrons from lactate are used by a cytoplasmic hydrogenase to generate hydrogen that can diffuse out across the cell membrane to be utilized by periplasmic dehydrogenases. Membrane potential is generated as protons remain in the periplasm while electrons are transferred across the cell membrane to reduce sulfate. When only hydrogen is utilized as an electron donor, it is likely oxidized in the periplasm by hydrogenases, but it may use different electron carriers in the reduction of sulfate than electrons generated during lactate oxidation.We know that lactate dehydrogenase, pyruvate-ferredoxin oxidoreductase, phosphotransacetylase, and acetate kinase convert lactate to acetate and that ATP sulfurylase, pyrophosphatase, adenosine-5Ј-phosphosulfate (APS) r...

Novel Genes of the dsr Gene Cluster and Evidence for Close Interaction of Dsr Proteins during Sulfur Oxidation in the Phototrophic Sulfur Bacterium Allochromatium vinosum

“…It has been proposed that these and related transmembrane complexes from sulfate-reducing bacteria are involved in the transport of electrons originating from oxidative metabolic pathways to the cytoplasmically located enzymes of sulfate reduction, namely, APS reductase and sulfite reductase (29,46,47,56,61,62). Indeed, several studies support the role of the D. vulgaris Hmc complex in transmembrane electron transport by linking periplasmic hydrogen oxidation to cytoplasmic sulfate reduction (19,39,55,69). Likewise, evidence has been provided that Hme functions as menaquinol:acceptor oxidoreductase in A. fulgidus, mediating the electron transfer from the quinone pool to an as yet unidentified electron carrier in the cytoplasm, which in turn is thought to function in its reduced form as an electron donor of the enzymes of sulfate reduction (46).…”

Effect of Oxidation Rate and Fe(II) State on Microbial Nitrate-Dependent Fe(III) Mineral Formation

“…Geochemical modeling using PHREEQC (38) DNA isolation, PCR amplification, cloning, sequencing, and phylogenetic analysis of isolates. Cells were disrupted by bead-beating in sodium dodecyl sulfate lysis buffer, and DNA was isolated from other cellular material by extraction with phenol-chloroform-isoamyl alcohol (51). 16S rRNA genes were amplified by PCR as described by Elshahed et al (25) using the universal forward primer 8f (5Ј AGAGTTTGAGCCTGGCTCAG 3Ј) and the universal reverse primer 804r (5Ј GACTACCAGGGTATCTAATCC 3Ј).…”

A Method Adapting Microarray Technology for Signature-Tagged Mutagenesis of Desulfovibrio desulfuricans G20 and Shewanella oneidensis MR-1 in Anaerobic Sediment Survival Experiments

“…A list of strains and plasmids used in this study is given in Table 1. Strain G20 was grown in lactate-sulfate (LS) medium prepared as described by Rapp and Wall (44), using N 2 headspace and vitamin and metal solutions as described elsewhere (50). Prior to autoclaving, the pH was adjusted to 7.2, and after autoclaving, 8 mM bicarbonate and 0.025% cysteine were added from anaerobic stock solutions.…”