Cis-diamminedichloroplatinum(II) Induced Distortion of a Single and Double Stranded Deoxydecanucleosidenona-phosphate Studied by Nuclear Magnetic Resonance

Abstract

The structural distortion of a single- and a double-stranded decadeoxynucleotide upon binding of cis-PtCl2(NH3)2 was studied by 1H-NMR. After selective platination of d(T-C-T-C-G-G-T-C-T-C) (I) at the central d(-GpG-) site (resulting in I-Pt), several non-exchangeable base protons as well as H1', H2', H2" and H3' protons could be assigned by means of conventional NMR double-resonance techniques. Addition of the complementary decamer strand to I and I-Pt yielded the double-stranded III and III-Pt, respectively. All non-exchangeable base, H1', and most of the H2' and H2" protons in the two double stranded compounds could be assigned using 2D-chemical shift correlation (COSY) and nuclear Overhauser enhancement (NOESY) techniques. The double stranded compound III appears to adopt a B-DNA like structure. Comparison of NOEs and proton-proton coupling constants in the d(-GpG-).cisPt part in I-Pt and III-Pt reveals that their structure displays large similarity. Significant chemical shift changes (i.e. larger than 0.1 ppm) between III and III-Pt are restricted to the central four base pairs. It follows that the outer three base pairs, located on either side of the central four base pairs in III-Pt are likely to adopt a regular B-DNA type helix. The observed large upfield and downfield chemical shifts in the d(-CpGpG-) part of III with respect to III-Pt can be rationalized by describing the distortion of the double helix as a kink. A discussion of the observed physical effects upon platination of a double-stranded oligonucleotide is presented.

Resonance assignments of non-exchangeable protons in B type DNA oligomers, an overview

“…We have DNA FRAGMENTS INCLUDED TABLE I IN THE DATA SET USED FOR 1H RESONANCE ASSIGNMENTS FRAGMENT CONDITIONS REFERENCE AAATTCTCAAA TTTGAGAATTT AAAAAATTTTTT ACTTACCTG CAGGTAAGT ACCCGGGT ATATATATAT TACCACTGGCGGTGATA TATCACCGCCAGTGGTA CACATGTG GAGATCTC CCAGAACAGTGG CCACTGTTCTGG CCGATTTTTCG CGAAAAATCGG CCGCTCA TGAGCGG CGCGAATTCGCG CGTACTAGTTAACTAGTACG TATCACCGCCAGAGGTA TACCTCTGGCGGTGATA (4,4-dimethylsilapentane-1-sulphonate) has been used for calibration of the chemical shift scale we have taken the data without modification. In some cases (11,28,32) Me4NCl (tetramethylammoniumchloride) has been used as a reference compound. We have converted the reported chemical shift values to the DSS scale by adding 3.18 ppm.…”

Cisplatin GG-crosslinks within single-stranded DNA: Origin of the preference for left-handed helicity

“…The latter retain, in spite of destacking, a right-handed helical orientation, which becomes manifest in significantly different chemical shifts of the two guanine H8 atoms, the 5′-H8 resonating considerably more downfield [5]. In 1985, Reedijk′s group made the intriguing observation that when a GG-cisplatinated DNA duplex dissociates, the H8 resonances of the single-stranded GG-Pt crosslink show an inverted order [6], indicating that the local helical twist at the GG step reverts to left-handed [7]. Why in single-stranded DNA the Pt-GG moiety prefers the left-handed helicity, has not been explained so far.…”

Photoinduced interactions of two dirhodium complexes with d(GTCGAC)2 probed by 2D NOESY

“…A notable example is the binding of cisplatin to the GG step of d(5′-TCTCGGTCTC-3′) annealed with its complementary strand, resulting in a 1,2-intrastrand cis -[Pt(NH 3 ) 2 {d(GpG)}] crosslink. 40 A dinuclear compound, [( cis -{Pt(NH 3 ) 2 }) 2 (μ-OH)(μ-pz)] 2+ (pz = pyrazole bridging ligand) forms a GpG intrastrand crosslink with d(5′-CTCTG*G*TCTC-3′)•d(5′-GAGACCAGAG-3′) (asterisks indicate location of metal binding); the binding of the complexes decreases the H1′-H1′ distance in the GpG step without a significant bend in the duplex’s helical axis compared to the unplatinated duplex. 41 Similarly, when [Rh 2 (O 2 CCH 3 ) 4 ] and single-stranded d(5′-CTCTCAACTTCC-3′) were incubated at 37 °C for 4–5 h, then annealed with the complementary strand, the downfield shifts by 0.4 – 0.6 ppm of the C 5 and A 6 signals were attributed to the formation of a 1,2-intrastrand adduct between these two nucleobases.…”