cag Pathogenicity island-dependent upregulation of matrix metalloproteinase-7 in infected patients with Helicobacter pylori

Abstract

Helicobacter pylori (H. pylori) infection has been involved in the pathogenesis of most important gastroduodenal diseases. Matrix metalloproteinases (MMPs) are a large family of zincendopeptidases which play important roles in degradation of extracellular matrix (ECM) and various inflammatory diseases. Therefore, we examined MMP-7 mRNA levels in the gastric mucosa of patients with H. pylori infection and evaluated the effects of virulence factors, such as vacA (vacuolating cytotoxin A) and cagA (cytotoxin-associated gene), in H. pylori-infected patients upon the MMP-7 mRNA mucosal levels. We also determined the correlation between mucosal MMP-7 mRNA levels and the types of disease. Total RNA was extracted from gastric biopsies of 50 H. pylori-infected patients and 50 uninfected individuals. Mucosal MMP-7 mRNA expression level in H. pylori-infected and non-infected gastric biopsies was determined by real-time polymerase chain reaction (PCR). The presences of cagA and vacA virulence factors was evaluated using PCR. MMP-7 expression was significantly higher in biopsies of patients infected with H .pylori compared to uninfected individuals. In addition, mucosal MMP-7 mRNA expression in H. pylori-infected patients significantly associated with the cagA status and the types of disease. Our results suggest that MMP-7 might be involved in the pathogenesis of H. pylori. Peptic ulcer was associated with cag pathogenicity island-dependent MMP-7 upregulation.

Matrix Metalloproteinases in Helicobacter pylori–Associated Gastritis and Gastric Cancer

“…An increase of MMP-7 levels in gastric biopsy specimens from patients infected with H. pylori has been demonstrated by several studies [43][44][45][46]. In contrast to MMP-9, MMP-7 localizes preferentially on the surface of epithelial cells and deep in the gastric gland, where chief cells are distributed [43].…”

“…Among bacterial factors responsible for MMPs synthesis and secretion in inflamed gastric mucosa, cagPAI but not VacA has been described in in vivo investigations [46]. In particular, Wu et al [55] have demonstrated that MMP-1 mRNA was overexpressed in samples from gastritis patients infected with cagPAI-and OipA-positive H. pylori.…”

Association Between Expression of Interleukin-32 Gene and Various Helicobacter pylori Virulence Factors in Human Infected Gastric Biopsy

“…One hundred and twenty-two specimens were collected from patients with dyspepsia referred to endoscopy center of Shahrekord Hajar Hospital, Iran, from June 2013 to March 2014. All patients were given consent about the procedure before their inclusion, in accordance with the Helsinki Declaration (8). Exclusion criteria were: age lowers than 18-year-old or more than 70, pregnancy, diabetes type-1, systemic infection, use of drugs effective against H. pylori in 1 month ago, alcohol abuse and chronic corticosteroid or nonsteroidal antiinflammatory drug use.…”

“…DNA extraction kit (BioFlux, Japan) was used For Genomic DNA extraction from all samples. The PCR protocol for CagA, OipA gene evaluation was done according to the previous study (8,12,13). To measure IL-32 mRNA expression, real-time PCR was performed, the designed primers and probes were shown in table 2.…”

“…Primer and probe sequence (5'-3') IL-32 F: GAATCAGGACGTGGACAGGTG R: CTCCTCATAATAAGCCGCCACTG P: FAM-CCCTCTTTGAAGTCGTCCTCCAGCTCTG-TAMRA β-actin F: AGCCTCGCCTTTGCCGA R: CTGGTGCCTGGGGCG P: FAM-CCGCCGCCCGTCCACACCCGCC-TAMRA RNA extraction bioZol ® kit was used for total RNA extraction. The Real-Time PCR protocol was used for the evaluation of the IL-32 mRNA expression levels in the biopsies according to the previous study (8). The Oligo.7 software was used for designing the sequences of β-actin and IL-32 primers and probe that are shown in Table 2 (1).…”