Agrobacterium‐Mediated Transformation of Setaria viridis, a Model System for Cereals and Bioenergy Crops

Abstract

Setaria viridis is an emerging model system for the genetic and molecular characterization of cereals and bioenergy crops. Here, we describe a detailed procedure for genetic transformation of the S. viridis accession line ME034V-1. This method utilizes callus generated from mature seeds for infection with Agrobacterium tumefaciens strain AGL1 to regenerate hygromycin-resistant stable transgenic plants. It takes approximately 7 weeks to generate callus from mature seeds, 11-17 weeks from infection to the regeneration of transgenic lines, and an additional 3-4 weeks for plant growth in the greenhouse for seed collection. The protocol as presented consistently results in transformation frequency of approximately 25% for the generation of transgenic plants, with fewer escapes and higher survivability in soil for optimal seed collection.

Transposon Insertion Drove the Loss of Natural Seed Shattering during Foxtail Millet Domestication

“…3 ). Three homozygous editing events (T 1 ) with a 1-bp insertion and 16-bp and 19-bp deletions in the sh1 coding sequence (CDS) were obtained from an easily shattering wild foxtail millet accession, ME034v, with a highly efficient transformation ( Finley et al 2021 ) ( fig. 3 a – c and supplementary fig.…”

“…The wild-type Sh1 gene from ME034v was edited with two gRNAs (TAGCACACATGCTCCAGCGCCGG and CTGCTGTCAGTGAACTTGAGAGG), targeting the first and second exons of Sh1 through the pRLG103 vector with the CRISPR/Cas9 system ( Čermák et al 2017 ) in a wild foxtail millet accession (ME034v) suitable for transformation with natural seed shattering ( Finley et al 2021 ). The overexpression construct harboring the CDS of Sh1 driven by the promoter of maize Ubiquitin was transformed into a domesticated foxtail millet cultivar (Ci846).…”

Mutations inNAKED-ENDOSPERMIDD genes reveal functional interactions withSCARECROWand a maternal influence on leaf patterning in C4grasses

“…Constructs were transformed into Kitaake rice seed using agrobacterium strain EHA105 as described previously (Hughes & Langdale, 2022). Constructs were transformed into setaria ME034V using a modified transformation protocol (Finley et al, 2021). In brief, ME034V seed were dehulled and 14 sterilised with 10% bleach plus 0.1% tween for 3 minutes.…”

Establishment of in vitro shoot tips regeneration system of foxtail millet and obtainment of transgenic plants of SiSERK1

“…seeds [16] and mature embryos [12][13][14][15]. In this study, the in vitro shoot tips of foxtail millet cultured in the dark for 4 days were mainly used, and the differentiation and rooting needed to be induced in the culture medium.…”

“…In 2007, the callus induced by young panicle of foxtail millet was used as the receptor material for GMP research for the rst time [10], and the factors affecting the transformation e ciency also were analyzed. Successively, the induced by in orescence [11], mature embryo [12][13][14][15], seeds [16] and young embryo [10] were used for genetic transformation research. So far, the progress has been made in the research on the tissue culture and genetic transformation of foxtail millet.…”