Hypothalamic neuropeptide expression following chronic food restriction in sedentary and wheel-running rats

Rijke, Corine E de; Hillebrand, J.J.G.; Verhagen, L.A.W.; Roeling, Tom A.P.; Adan, R.A.H.

doi:10.1677/jme.1.01808

Cited by 100 publications

(69 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…We have observed similar findings in the male genotype of this rodent model in which increased exercise activity under energy restriction conditions appears to promote behaviours associated with food foraging and food-related travel (Mistlberger et al 2006). Furthermore, the total distance run by animals was found to be negatively correlated with total food intake in ERExercise animals, suggesting the increase in exercise activity stimulated an increase in food-seeking travel behaviour, consistent with previous observations (De Rijke et al 2005. Cardiometabolic risk parameters in the obese PCOSprone animals were shown to improve with both exercise and dietary energy restriction.…”

Section: Hypothalamic Arc Neuropeptide and Peptide Expressionsupporting

confidence: 91%

Cardiometabolic and reproductive benefits of early dietary energy restriction and voluntary exercise in an obese PCOS-prone rodent model

Diané

Kupreeva

Borthwick

et al. 2015

Journal of Endocrinology

View full text Add to dashboard Cite

Polycystic ovary syndrome (PCOS) is one of the most common endocrine-metabolic disorders in women of reproductive age characterized by ovulatory dysfunction, hyperandrogenism and cardiometabolic risk. The overweight-obese PCOS phenotype appears to have exacerbated reproductive dysfunction and cardiometabolic risk. In overweight-obese adult women with PCOS, exercise and energy restricted diets have shown limited and inconsistent effects on both cardiometabolic indices and reproductive outcomes. We hypothesized that an early lifestyle intervention involving exercise and dietary energy restriction to prevent or reduce the propensity for adiposity would modulate reproductive indices and cardiometabolic risk in an obese PCOS-prone rodent model. Weanling obese PCOS-prone and Lean-Control JCR:LA-cp rodents were given a chow diet ad libitum or an energyrestricted diet combined with or without voluntary exercise (4 h/day) for 8 weeks. Dietary energy restriction and exercise lowered total body weight gain and body fat mass by 30% compared to free-fed sedentary or exercising obese PCOS-prone animals (P!0.01). Energy restriction induced an increase in exercise intensity compared to free-feeding plus exercise conditions. Energy restriction and exercise decreased fasting plasma triglycerides and apoB48 concentrations in obese PCOS-prone animals compared to free-fed and exercise or sedentary groups. The energy restriction and exercise combination in obese PCOS-prone animals significantly increased plasma sex-hormone binding globulin, hypothalamic cocaine-and amphetamine-regulated transcript (CART) and Kisspeptin mRNA expression to levels of the Lean-Control group, and this was further associated with improvements in estrous cyclicity. The combination of exercise and dietary energy restriction when initiated in early life exerts beneficial effects on cardiometabolic and reproductive indices in an obese PCOS-prone rodent model, and this may be associated with normalization of the hypothalamic neuropeptides, Kisspeptin and CART.

show abstract

Section: Hypothalamic Arc Neuropeptide and Peptide Expressionsupporting

confidence: 91%

Cardiometabolic and reproductive benefits of early dietary energy restriction and voluntary exercise in an obese PCOS-prone rodent model

Diané

Kupreeva

Borthwick

et al. 2015

Journal of Endocrinology

View full text Add to dashboard Cite

show abstract

“…The ghrelin-induced increased food hoarding was more consistently blocked by MTII than the ghrelin-induced increased food intake. Food deprivation-induced increases in food intake, as with ghrelin, appear to act at least partially through MC3/4-R in laboratory rats (e.g., (Kas et al, 2003;de Rijke et al, 2005) and, in the present study, the few times food intake was elevated post food deprivation, MTII consistently blocked this increase. Unlike the ability of MTII to block the effects of ghrelin on food hoarding, MTII was only able to attenuate fasting-induced increases in food hoarding.…”

Section: Discussionsupporting

confidence: 64%

MTII attenuates ghrelin- and food deprivation-induced increases in food hoarding and food intake

Keen-Rhinehart

Bartness

2007

Hormones and Behavior

View full text Add to dashboard Cite

Food deprivation triggers a constellation of physiological and behavioral changes including increases in peripherally-produced ghrelin and centrally-produced agouti-related protein (AgRP). Upon refeeding, food intake is increased in most species, however hamsters primarily increase food hoarding. Food deprivation-induced increases in food hoarding by Siberian hamsters are mimicked by peripheral ghrelin and central AgRP injections. Because food deprivation stimulates ghrelin as well as AgRP synthesis/release, food deprivation-induced increases in hoarding may be mediated by melanocortin 3 or 4 receptor (MC3/4-R) antagonism via AgRP, the MC3/4-R inverse agonist. Therefore, we asked: Can a MC3/4-R agonist block food deprivation-or ghrelin-induced increases in foraging, food hoarding and food intake? This was accomplished by injecting melanotan II (MTII), a synthetic MC3/4-R agonist, into the 3 rd ventricle in food deprived, fed or peripheral ghrelin injected hamsters and housed in a running wheel-based food delivery foraging system. Three foraging conditions were used: a) no running wheel access, non-contingent food, b) running wheel access, non-contingent or c) a foraging requirement for food (10 revolutions/pellet). Food deprivation was a more potent stimulator of foraging and hoarding than ghrelin. Concurrent injections of MTII completely blocked food deprivation-and ghrelin-induced increases in food intake and attenuated, but did not always completely block, food deprivation-and ghrelin-induced increases in food hoarding. Collectively, these data suggest that the MC3/4-R are involved in ghrelin-and food deprivation-induced increases in food intake, but other neurochemical systems, such as previously demonstrated with neuropeptide Y, also are involved in increases in food hoarding as well as foraging.

show abstract

“…Sequences for primers were reported previously (de Rijke et al, 2005) except for orexin promoter: cyclophilin (60°), GCCTGTG-GAATGTGAGGGGTG CATCTATGGTGAGCGCTTCCCA; orexin (60°), GCCGTCTCTACGAACTGTTG CGAGGAGAGGGGAAGT-TAG; orexin promoter (60°), GGAGTTTGGTGAAAGGGACAG CTGGGTGGCATACCCTCTCA.…”

Section: Methodsmentioning

confidence: 99%

Orexin Signaling Mediates the Antidepressant-Like Effect of Calorie Restriction

Lutter

Krishnan²,

Russo³

et al. 2008

J. Neurosci.

214

160

View full text Add to dashboard Cite

During periods of reduced food availability, animals must respond with behavioral adaptations that promote survival. Despite the fact that many psychiatric syndromes include disordered eating patterns as a component of the illness, little is known about the neurobiology underlying behavioral changes induced by short-term calorie restriction. Presently, we demonstrate that 10 d of calorie restriction, corresponding to a 20 -25% weight loss, causes a marked antidepressant-like response in two rodent models of depression and that this response is dependent on the hypothalamic neuropeptide orexin (hypocretin). Wild-type mice, but not mice lacking orexin, show longer latency to immobility and less total immobility in the forced swim test after calorie restriction. In the social defeat model of chronic stress, calorie restriction reverses the behavioral deficits seen in wild-type mice but not in orexin knock-out mice. Additionally, chronic social defeat stress induces a prolonged reduction in the expression of prepro-orexin mRNA via epigenetic modification of the orexin gene promoter, whereas calorie restriction enhances the activation of orexin cells after social defeat. Together, these data indicate that orexin plays an essential role in mediating reduced depression-like symptoms induced by calorie restriction.

show abstract

Hypothalamic neuropeptide expression following chronic food restriction in sedentary and wheel-running rats

Cited by 100 publications

References 53 publications

Cardiometabolic and reproductive benefits of early dietary energy restriction and voluntary exercise in an obese PCOS-prone rodent model

Cardiometabolic and reproductive benefits of early dietary energy restriction and voluntary exercise in an obese PCOS-prone rodent model

MTII attenuates ghrelin- and food deprivation-induced increases in food hoarding and food intake

Orexin Signaling Mediates the Antidepressant-Like Effect of Calorie Restriction

Contact Info

Product

Resources

About