Hypermethylation of CpG Islands and Shores around Specific MicroRNAs and Mirtrons Is Associated with the Phenotype and Presence of Bladder Cancer

Dudziec, Ewa; Miah, Saiful; Choudhry, Hani; Owen, Helen; Blizard, Sheila; Glover, Maggie; Hamdy, Freddie C.; Catto, James W.F.

doi:10.1158/1078-0432.ccr-10-2017

Cited by 86 publications

(64 citation statements)

References 36 publications

(54 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The methylation of mir-152 was reportedly associated with an advanced tumor stage and a poorer PFS in patients with bladder cancer. (17) The regulation of miRNAs is believed to be highly tissue specific; (18) thus, the role of miR-152, if any, may not be dominant in lung cancer.…”

Section: Discussionmentioning

confidence: 99%

CpG island methylation of microRNAs is associated with tumor size and recurrence of non‐small‐cell lung cancer

Kitano

Watanabe²,

Emoto³

et al. 2011

Cancer Science

View full text Add to dashboard Cite

We investigated whether the CpG island methylation of certain microRNAs was associated with the clinicopathological features and the prognosis of non-small-cell lung cancer. The methylation of mir-152, -9-3, -124-1, -124-2, and -124-3 was analyzed in 96 nonsmall-cell lung cancer specimens using a combined bisulfite restriction analysis. The median observation period was 49.5 months. The methylation of mir-9-3, -124-2, and -124-3 was individually associated with an advanced T factor independent of age, sex, and smoking habit. Moreover, the methylation of multiple microRNA loci was associated with a poorer progression-free survival in a univariate analysis. Our result enlightens the accumulation of aberrant DNA methylation which occurs in concordance with the tumor progression. (Cancer Sci 2011; 102: 2126-2131 L ung cancer is the leading cause of cancer-related mortality in the world,(1) and non-small-cell lung cancer (NSCLC) is the most common type. Surgical resection remains the only curative treatment for NSCLC. Identifying factors that are associated with aggressive disease may lead to the development of novel biomarkers and the identification of therapeutic targets that can help reduce the burden of this disease.MicroRNAs (miRNAs) are a class of small non-coding RNAs that negatively regulate target gene expression by accelerating the degradation of mRNA and translational inhibition, with potentially hundreds of target mRNAs.(2) They influence a variety of cellular functions including proliferation, differentiation, and apoptosis.(3) Specific miRNAs can behave as either tumor suppressor genes or oncogenes, depending on the tissue type and the presence of specific targets. (4,5) More than 100 species of known miRNAs are embedded within or near the CpG islands of the human genome and are potentially subject to control by epigenetic alterations such as DNA methylation and histone modification. Systematic assessments of miRNA expression and epigenetic modifications among cell lines and primary tumor specimens have revealed the existence of the epigenetic regulation of miRNAs in multiple tumor types. (6)(7)(8)(9) The goals of this study were to explore possible relationships between the methylation profiles of miRNAs and the clinicopathological characteristics of NSCLC patients and to identify new specific methylation markers capable of detecting advanced pathological features.In the present study, the methylation status of five miRNA loci within five separate CpG islands was determined in 96 NSCLC tissue specimens. The choice of the miRNAs was based on our previous study (9) as well as other published reports. (10,11) Our data show that the CpG island methylation of miRNAs is common in NSCLC, and that the methylation of multiple miR-NA loci is associated with an advanced T status as well as the progression-free survival (PFS) of patients with NSCLC. Materials and MethodsPatients. We collected cancer tissues and normal lung tissues from NSCLC patients who underwent surgical resection at the University of Tokyo Hosp...

show abstract

Section: Discussionmentioning

confidence: 99%

CpG island methylation of microRNAs is associated with tumor size and recurrence of non‐small‐cell lung cancer

Kitano

Watanabe²,

Emoto³

et al. 2011

Cancer Science

View full text Add to dashboard Cite

show abstract

“…We measured the expression of any identified short RNA sequences using custom stem loop primers (TaqMan small RNA assays; Applied Biosystems) with real-time qPCR (as described in ref. 19) in cell lines and human tissues samples.…”

Section: Identification Of Hairpin Rna Structuresmentioning

confidence: 99%

“…Total RNA was extracted using the mirVana Extraction Kit (Ambion) and measured using a 2100 Bioanalyzer [Agilent; as described elsewhere (19)]. RNA expression was determined using real-time quantitative RT-PCR with primers for PCA3, BMCC1, PSA (4, 7), and two custom stem loop hairpin primers for PCA3-shRNA2 [termed "a" and "b": target sequences (ACTGCACTCCA-GCCTGGGCA) and (CACTGCACTCCAGCCTGGGCA) Ambion: assay IDs, SCSGJ090 and CSHSNF8, respectively] using qRT-PCR (21).…”

Section: Rna Extraction and Quantificationmentioning

confidence: 99%

Identification and Diagnostic Performance of a Small RNA within the PCA3 and BMCC1 Gene Locus That Potentially Targets mRNA

Drayton

Rehman

Clarke

et al. 2015

Cancer Epidemiology, Biomarkers &Amp; Prevention

Self Cite

View full text Add to dashboard Cite

Background: PCA3 is a long noncoding RNA (lncRNA) with unknown function, upregulated in prostate cancer. LncRNAs may be processed into smaller active species. We hypothesized this for PCA3.Methods: We computed feasible RNA hairpins within the BMCC1 gene (encompassing PCA3) and searched a prostate transcriptome for these. We measured expression using qRT-PCR in three cohorts of prostate cancer tissues (n ¼ 60), exfoliated urinary cells (n ¼ 484 with cancer and n ¼ 166 controls), and in cell lines (n ¼ 22). We used in silico predictions and RNA knockup to identify potential mRNA targets of short transcribed RNAs.Results: We predicted 13 hairpins, of which PCA3-shRNA2 was most abundant within the prostate transcriptome. PCA3-shRNA2 is located within intron 1 of PCA3 and appears regulated by androgens. Expression of PCA3-shRNA2 was upregulated in

show abstract

“…In a large case-control study conducted by Moore et al (2008), the DNA hypomethylation of leukocytes was strongly associated with an increased bladder cancer risk, and this association was independent of smoking and other assessed risk factors. Recently, evidence has emerged that circulating miRNAs are present in human body fluids (as urine) in concentrations that are subject to variation during cancer pathogenesis or development (Iguchi et al, 2010), as was reported by Dudziec et al (2011). The authors discovered that the combined low expression levels of miR-152, -328 and -1224-3p allowed for accurate diagnosis with 81% sensitivity and 75% specificity.…”

Section: Candidate Epigenetic Biomarkers In the Diagnosis Of Bladder mentioning

confidence: 93%

Epigenetic Biomarkers in Bladder Cancer

Zimbardi¹,

Reis²,

Prando³

et al. 2012

Bladder Cancer - From Basic Science to Robotic Surgery

View full text Add to dashboard Cite

Hypermethylation of CpG Islands and Shores around Specific MicroRNAs and Mirtrons Is Associated with the Phenotype and Presence of Bladder Cancer

Cited by 86 publications

References 36 publications

CpG island methylation of microRNAs is associated with tumor size and recurrence of non‐small‐cell lung cancer

CpG island methylation of microRNAs is associated with tumor size and recurrence of non‐small‐cell lung cancer

Identification and Diagnostic Performance of a Small RNA within the PCA3 and BMCC1 Gene Locus That Potentially Targets mRNA

Epigenetic Biomarkers in Bladder Cancer

Contact Info

Product

Resources

About