Hydroxysafflor yellow A inhibits TGF-β1-induced activation of human fetal lung fibroblasts<i>in vitro</i>

Pan, Ruiyan; Zhang, Yadan; Zang, Baoxia; Tan, Li; Jin, Ming

doi:10.1111/jphp.12596

Cited by 19 publications

(21 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previously, we showed that MRC-5 cells treated with HSYA for 72 h could inhibit TGF-β1-induced cell proliferation in a dose-dependent manner (Pan et al, 2016). To determine how early this effect appeared, we monitored the effect of HSYA on TGF-β1-induced cell proliferation after 24, 48, or 72 h. As depicted in Supplementary Figure S1 , the OD measure of proliferation of MRC-5 cells was lower in the TGF-β1+HSYA treated group as compared to the group treated with TGF-β1 alone after 48 or 72 h. This effect was dose dependent.…”

Section: Resultsmentioning

confidence: 99%

“…HSYA analysis was performed using a high-performance liquid chromatography system (Wang Y. et al, 2014). The purity of the HSYA was previously determined by the area normalization method to be 95.2% (Pan et al, 2016). …”

Section: Methodsmentioning

confidence: 99%

“…Real-time PCR was performed using a SYBR ® Premix Ex Taq TM Kit with a Bio-Rad iCycler iQ5 Detection System (Bio-Rad, Hercules, CA, USA). The PCR amplification conditions were as described previously (Pan et al, 2016). The primer sequences and lengths (in bp) were as follows (5′–3′): MMP-2: TGAGCTATGGACCTTGGGAGAA (forward) and CCATCGGCGTTCCCATAC (reverse), 60 bp; TIMP-1: CTGTTGTTGCTGTGGCTGATAG (forward) and AAGGTGGTCTGGTTGACTTCTG (reverse), 137 bp; TIMP-2: GGGAAGGATTTTGGAGGTAGG (forward) and GGAGGCTGAGAAAGAAGTGAGTG (reverse), 58 bp.…”

Section: Methodsmentioning

confidence: 99%

“…HSYA also ameliorated renal fibrosis by suppressing TGF-β1-induced epithelial-to-mesenchymal transition (Hu et al, 2016). We previously reported that HSYA could attenuate BLM-induced pulmonary fibrosis (Jin et al, 2016) and inhibit TGF-β1-induced activation of human fetal lung fibroblasts (Pan et al, 2016), but the precise mechanisms and target of HSYA’s anti-fibrosis activity remain unclear.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Hydroxysafflor Yellow A Suppresses MRC-5 Cell Activation Induced by TGF-β1 by Blocking TGF-β1 Binding to TβRII

et al. 2017

Self Cite

View full text Add to dashboard Cite

Hydroxysafflor yellow A (HSYA) is an active ingredient of Carthamus tinctorius L.. This study aimed to evaluate the effects of HSYA on transforming growth factor-β1 (TGF-β1)-induced changes in proliferation, migration, differentiation, and extracellular matrix accumulation and degradation in human fetal lung fibroblasts (MRC-5), to explore the mechanisms whereby HSYA may alleviate pulmonary fibrosis. MRC-5 cells were incubated with various doses of HSYA and/or the TGF-β receptor type I kinase inhibitor SB431542 and then stimulated with TGF-β1. Cell proliferation was measured by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfo-phenyl)-2H-tetrazolium inner salt assay. Cell migration was detected by wound-healing assay. Protein levels of α-smooth muscle actin (α-SMA), collagen I α 1 (COL1A1), and fibronectin (FN) were measured by immunofluorescence. Protein levels of matrix metalloproteinase-2, tissue inhibitor of matrix metalloproteinase-1, tissue inhibitor of matrix metalloproteinase-2, TGF-β type II receptor (TβRII), and TGF-β type I receptor were detected by western blotting. TβRII knockdown with siRNA interfered with the inhibitory effect of HSYA on α-SMA, COL1A1, and FN expression, and TGF-β1-induced Sma and Mad protein (Smad), and extracellular signal-regulated kinase/mitogen-activated protein kinase signaling pathway activation. The antagonistic effect of HSYA on the binding of fluorescein isothiocyanate-TGF-β1 to MRC-5 cell cytoplasmic receptors was measured by flow cytometry. HSYA significantly suppressed TGF-β1-induced cell proliferation and migration. HSYA could antagonize the binding of FITC-TGF-β1 to MRC-5 cell cytoplasmic receptors. Also HSYA inhibited TGF-β1-activated cell expression of α-SMA, COL1A1, and FN and phosphorylation level of Smad2, Smad3, and ERK by targeting TβRII in MRC-5 cells. These findings suggest that TβRII might be the target responsible for the inhibitory effects of HSYA on TGF-β1-induced pathological changes in pulmonary fibrosis.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Hydroxysafflor Yellow A Suppresses MRC-5 Cell Activation Induced by TGF-β1 by Blocking TGF-β1 Binding to TβRII

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…, TGF-. TGFSmad Smad extracellular signalregulated kinase (ERK), c-Jun-N-terminal kinase (JNK), p38 MAPK mitogen activated protein (MAP) kinases phosphoinositide 3-kinase/Akt (PI3K/Akt) (Pan et al, 2016). fucoidan 4 cells/mL and incubated with various fucoidan concentrations (1, 5, and 10 µg/mL) for 1 h prior to TGF-β1 stimulation (1 ng/mL).…”

Section: 결과 및 고찰mentioning

confidence: 99%

Inhibitory Effect of Fucoidan on TGF-β1-Induced Activation of Human Pulmonary Fibroblasts

Yim¹,

Lee²,

Choi³

et al. 2016

Korean Journal of Fisheries and Aquatic Sciences

View full text Add to dashboard Cite

Fucoidan, one of the dominant sulfated polysaccharides extracted from brown seaweed, possesses a wide range of biological activities. Transforming growth factor-β (TGF-β) plays a pivotal role in the pathogenesis of pulmonary fibrosis, by stimulating the synthesis of profibrotic factors. In this study, we investigated the in vitro effects of fucoidan on collagen synthesis, α-smooth muscle actin (α-SMA) expression, and interleukin (IL)-6 production in TGF-β-stimulated human pulmonary fibroblasts. The expression of type I collagen and α-SMA was detected by Western blot, and the production of IL-6 by enzyme-linked immunosorbent assay. TGF-β1 treatment of pulmonary fibroblasts enhanced the expression of α-SMA, type I collagen, and IL-6 whereas these effects were inhibited in cells pretreated with fucoidan. The activation of Smad2/3, p38 mitogen-activated protein kinases (MAPKs), and Akt was also inhibited in fucoidan-pretreated, TGF-β1-stimulated human pulmonary fibroblasts. These data demonstrate the anti-fibrotic potential of fucoidan in TGF-β-induced human pulmonary fibroblasts, via the inhibition of Smad2/3, p38 MAPKs, and Akt phosphorylation. Our results suggest the therapeutic potential of fucoidan in the prevention or treatment of pulmonary fibrosis.

show abstract

Honokiol inhibits epithelial–mesenchymal transition and hepatic fibrosis via activation of Ecadherin/GSK3β/JNK and inhibition of AKT/ERK/p38/β‐catenin/TMPRSS4 signaling axis

Seo

Lee

Sim

et al. 2023

Phytotherapy Research

View full text Add to dashboard Cite

Though Honokiol was known to have anti‐inflammatory, antioxidant, anticancer, antithrombotic, anti‐viral, metabolic, antithrombotic, and neurotrophic activities, the underlying mechanisms of Honokiol on epithelial–mesenchymal transition (EMT) mediated liver fibrosis still remain elusive so far. Anti‐EMT and antifibrotic effects of Honokiol were explored in murine AML‐12 hepatocyte cells by 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyl‐2H‐tetrazolium bromide (MTT) assay, wound healing assay, Western blotting and also in CCl4‐induced liver injury mouse model by immunohistochemistry. Honokiol significantly suppressed transforming growth factor β1 (TGF‐β1)‐induced EMT and migration of AML‐12 cells along with decreased EMT phenotypes such as loss of cell adhesion and formation of fibroblast like mesenchymal cells in TGF‐β1‐treated AML‐12 cells. Consistently, Honokiol suppressed the expression of Snail and transmembrane protease serine 4 (TMPRSS4), but not p‐Smad3, and activated E‐cadherin in TGF‐β1‐treated AML‐12 cells. Additionally, Honokiol reduced the expression of β‐catenin, p‐AKT, p‐ERK, p‐p38 and increased phosphorylation of glycogen synthase kinase 3 beta (GSK3β) and JNK in TGF‐β1‐treated AML‐12 cells via TGF‐β1/nonSmad pathway. Conversely, GSK3β inhibitor SB216763 reversed the ability of Honokiol to reduce Snail, β‐catenin and migration and activate E‐cadherin in TGF‐β1‐treated AML‐12 cells. Also, Honokiol suppressed hepatic steatosis and necrosis by reducing the expression of TGF‐β1 and α‐SMA in liver tissues of CCl4 treated mice. These findings provide scientific evidence that Honokiol suppresses EMT and hepatic fibrosis via activation of E‐cadherin/GSK3β/JNK and inhibition of AKT/ERK/p38/β‐catenin/TMPRSS4 signaling axis.

show abstract

Hydroxysafflor yellow A inhibits TGF-β1-induced activation of human fetal lung fibroblastsin vitro

Abstract: These findings suggest that HSYA inhibits TGF-β1-induced activation of MRC-5 cells associated with TGF-β1/Smad and ERK/MAPK signalling pathways.

Cited by 19 publications

References 40 publications

Hydroxysafflor Yellow A Suppresses MRC-5 Cell Activation Induced by TGF-β1 by Blocking TGF-β1 Binding to TβRII

Hydroxysafflor Yellow A Suppresses MRC-5 Cell Activation Induced by TGF-β1 by Blocking TGF-β1 Binding to TβRII

Inhibitory Effect of Fucoidan on TGF-β1-Induced Activation of Human Pulmonary Fibroblasts

Honokiol inhibits epithelial–mesenchymal transition and hepatic fibrosis via activation of Ecadherin/GSK3β/JNK and inhibition of AKT/ERK/p38/β‐catenin/TMPRSS4 signaling axis

Contact Info

Product

Resources

About