Human α Spectrin II and the FANCA, FANCC, and FANCG Proteins Bind to DNA Containing Psoralen Interstrand Cross-Links

Lw, McMahon; Sangerman, Jose; Goodman,; Kumaresan, Kandallu R.; Mw, Lambert

doi:10.1021/bi002917g

Cited by 73 publications

(193 citation statements)

References 57 publications

Supporting

Mentioning

181

Contrasting

Order By: Relevance

“…The top strand, (5'-GCGAGCCGACGACCGCGCCCTACTGATGAGACCACTACTGATGTTTTTTCCGAC GACGACGAGCCTACCACTGACTGAGCACTGAGCACTGAG-3'), which was biotinylated on the 5' end, and the bottom strand (5'-CTCAGTGCTCAGTGCTCAGTCAGTGGTAGGCTCGTCGTCGTCGGAAAAAACATC AGTAGTGGTCTCATCAGTAGGGCGCGGTCGTCGGCTCGC-3') were synthesized by Operon Biotechnologies (Huntsville, AL). Construction of the duplex substrate and hybridization of the strands was carried out as previously described [19]. The DNA was then irradiated with 245 J/m 2 UVC light.…”

Section: Dna Binding Assaysmentioning

confidence: 99%

See 1 more Smart Citation

Domains in the XPA protein important in its role as a processivity factor

Bartels

Lambert

2007

Biochemical and Biophysical Research Communications

Self Cite

View full text Add to dashboard Cite

XPA is a protein essential for nucleotide excision repair (NER) where it is thought to function in damage recognition/verification. We have proposed an additional role, that of a processivity factor, conferring a processive mechanism of action on XPF and XPG, the endonucleases involved in NER. The present study was undertaken to examine the domain(s) in the XPA gene that are important for the ability of the XPA protein to function as a processivity factor. Using site-directed mutagenesis, mutations were created in several of the exons of XPA and mutant XPA proteins produced. The results showed that the DNA binding domain of XPA is critical for its ability to act as a processivity factor. Mutations in both the zinc finger motif and the large basic cleft in this domain eliminated the ability of XPA to confer a processive mechanism of action on the endonucleases involved in NER.Keywords xeroderma pigmentosum; XPA protein; DNA repair; processive mechanism of action Though the XPA protein is a key component in NER, its precise function in this repair pathway is not clear. There is evidence that it plays a role in the initial steps of NER, where it is involved in damage recognition/verification [1][2][3]. We have proposed an additional important function for XPA, that of a processivity factor needed to confer a processive mechanism of action on the endonucleases, XPF and XPG, involved in NER [4,5]. Proteins can locate target sites on DNA by two distinctive mechanisms: (1) a processive mechanism in which a protein first binds to a random site on DNA and then translocates to a specific site by a facilitated-diffusion process in which it slides or hops along the DNA; or (2) a distributive mechanism, in which a protein has no affinity for non-target DNA and locates target sites by a random, threedimensional diffusion process [6][7][8][9]. The mechanism utilized by DNA-targeting proteins is extremely important in determining the ability of the protein to properly interact with its target sites on DNA and, for many of these proteins, a processive mechanism of action is essential [6,8] We have previously shown that during repair of UVC light induced cyclobutane pyrimidine dimers in normal human cells, the endonucleases, XPG and XPF, incise DNA at sites of damage using a processive mechanism of action [4,5]. In contrast, these endonucleases in cells from

show abstract

Section: Dna Binding Assaysmentioning

confidence: 99%

“…Streptavidin-coated acrylamide beads (Pierce) were then added to the DNA binding reaction as previously described [19] and incubation was continued at 4°C for 15 min. The beads/bound DNA and protein were pelleted by centrifugation (2500 × g at 4°C) and washed 4 times in DNA binding buffer.…”

Section: Dna Binding Assaysmentioning

confidence: 99%

Domains in the XPA protein important in its role as a processivity factor

Bartels

Lambert

2007

Biochemical and Biophysical Research Communications

Self Cite

View full text Add to dashboard Cite

show abstract

“…Alpha spectrin is identified at the nuclear envelope [30]. More recently, Lambert and colleagues demonstrated that SpαII is involved in DNA repair in the nucleus [19,20,48,49] (Tab. 2).…”

Section: Suggested Functions In Nucleimentioning

confidence: 99%

“…Spectrin is generally considered to be a structural (cytoskeletal) protein involved in stabilization of cell surface membranes at sites of cell-cell contacts [17], protein sorting [9], and protein accumulation [18]. Spectrin is also involved in regulation of signal transduction pathways [12], and in the regulation of DNA repair [19,20]. However, studies of gene knock-outs in model organisms suggest that these genes are not essential for fundamental cellular function, but act at the level of integration of cells into tissues, and, thus, mutations may be compatible with survival but impart impaired physiological function, and are therefore candidates to cause disease in humans [14].…”

Section: Introductionmentioning

confidence: 99%

Brain proteins interacting with the tetramerization region of non-erythroid alpha spectrin

Fung

2007

Cellular and Molecular Biology Letters

View full text Add to dashboard Cite

Abstract:The N-terminal region of non-erythroid alpha spectrin (SpαII) is responsible for interacting with its binding partner, beta spectrin, to form functional spectrin tetramers. We used a yeast-two-hybrid system, with an N-terminal segment of alpha spectrin representing the functional tetramerization site, as a bait to screen human brain c-DNA library for proteins that interact with the alpha spectrin segment. In addition to several beta spectrin isoforms, we identified 14 proteins that interact with SpαII. Seven of the 14 were matched to 6 known proteins: Duo protein, Lysyl-tRNA synthetase, TBP associated factor 1, two isoforms (b and c) of a protein kinase A interacting protein and Zinc finger protein 333 (2 different segments). Four of the 6 proteins are located primarily in the nucleus, suggesting that spectrin plays important roles in nuclear functions. The remaining 7 proteins were unknown to the protein data base. Structural predictions show that many of the 14 proteins consist of a large portion of unstructured regions, suggesting that many of these proteins fold into a rather flexible conformation. It is interesting to note that all but 3 of the 14 proteins are predicted to consist of one to four coiled coils (amphiphilic helices). A mutation in SpαII, V22D, which interferes with the coiled coil bundling of SpαII with beta spectrin, also affects SpαII interaction with Duo protein, TBP associated factor 1 and Lysyl-tRNA synthetase, suggesting that they may compete with beta spectrin for interaction with SpαII. Future structural and functional studies of these proteins to provide interaction mechanisms will no doubt lead to a better understanding of brain physiology and pathophysiology.

show abstract

“…This complex contains proteins involved in both damage recognition and incision of crosslinked DNA (Hang et al, 1993;Kumaresan et al, 1995;Lambert and Lambert, 1999). We have recently identified a structural protein, nonerythroid α spectrin (αSpIIΣ*), as a component of this protein complex in normal human cell nuclei and have shown that it binds directly to DNA containing a 4,5′,8-trimethylpsoralen (TMP) plus UVA-light-induced interstrand cross-link and plays a role in the initial damage recognition/incision steps involved in the repair of this lesion McMahon et al, 2001). We have also shown that the nucleotide excision repair protein XPF is involved in the repair of this interstrand cross-link and that it functions in production of the incisions made on the 5′ side and 3′ side of the cross-link (Kumaresan and Lambert, 2000;Kumaresan et al, 2002).…”

Section: Introductionmentioning

confidence: 99%

Nonerythroid αII spectrin is required for recruitment of FANCA and XPF to nuclear foci induced by DNA interstrand cross-links

Sridharan

Brown

Lambert

et al. 2003

Journal of Cell Science

Self Cite

200

View full text Add to dashboard Cite

The events responsible for repair of DNA interstrand cross-links in mammalian cells, the proteins involved and their interactions with each other are poorly understood. The present study demonstrates that the structural protein nonerythroid α spectrin (αSpIIΣ*), present in normal human cell nuclei, plays an important role in repair of DNA interstrand cross-links. These results show that αSpIIΣ* relocalizes to nuclear foci after damage of normal human cells with the DNA interstrand cross-linking agent 8-methoxypsoralen plus ultraviolet A (UVA) light and that FANCA and the known DNA repair protein XPF localize to the same nuclear foci. That αSpIIΣ* is essential for this re-localization is demonstrated by the finding that in cells from patients with Fanconi anemia complementation group A (FA-A), which have decreased ability to repair DNA interstrand cross-links and decreased levels of αSpIIΣ*, there is a significant reduction in formation of damage-induced XPF as well asαSpIIΣ* nuclear foci, even though levels of XPF are normal in these cells. In corrected FA-A cells, in which levels of αSpIIΣ*are restored to normal, numbers of damage-induced nuclear foci are also returned to normal. Co-immunoprecipitation studies show thatαSpIIΣ*, FANCA and XPF co-immunoprecipitate with each other from normal human nuclear proteins. These results demonstrate thatαSpIIΣ*, FANCA and XPF interact with each other in the nucleus and indicate that there is a close functional relationship between these proteins. These studies suggest that an important role for αSpIIΣ* in the nucleus is to act as a scaffold, aiding in recruitment and alignment of repair proteins at sites of damage.

show abstract

Human α Spectrin II and the FANCA, FANCC, and FANCG Proteins Bind to DNA Containing Psoralen Interstrand Cross-Links

Cited by 73 publications

References 57 publications

Domains in the XPA protein important in its role as a processivity factor

Domains in the XPA protein important in its role as a processivity factor

Brain proteins interacting with the tetramerization region of non-erythroid alpha spectrin

Nonerythroid αII spectrin is required for recruitment of FANCA and XPF to nuclear foci induced by DNA interstrand cross-links

Contact Info

Product

Resources

About