Human RPE Expression of Cell Survival Factors

Abstract

Multiple RPE cell survival factors are expressed by human RPE cells. TNF-alpha regulates expression of some of these factors in an NF-kappaB-dependent manner, whereas others are not influenced by NF-kappaB. RPE cell survival factors may protect RPE cells from apoptosis normally and in diseases such as age-related macular degeneration (AMD) and proliferative vitreoretinopathy (PVR).

Caspase-8–Mediated Apoptosis in Human RPE Cells

“…15 Briefly, duplicate reactions were prepared with 20 L PCR master mix consisting of 10 L master mix (iQ SYBR Green Supermix; Bio-Rad, Hercules, CA), 1 L cDNA template, 1 L each of caspase-8 primer pair (20 nM; forward, CTGCTGGGGATGGCCACT-GTG; reverse, TCGCCTCGAGGACATCGCTCTC), and 7 L RNase-free water. Reactions were denatured at 95°C for 2 minutes and amplified for 50 cycles at 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 15 seconds.…”

“…15 For Western blot, membranes were incubated overnight at 4°C with the following antibodies (Cell Signaling Technology, Beverly, MA) diluted in 3% milk: mouse monoclonal antibody directed against caspase-8 (9746, 1:1000), rabbit monoclonal antibody directed against caspase-3 (9665, 1:1000), rabbit polyclonal antibody directed against Bid (2002, 1:1000), caspase-7 (9492, 1:1000), and caspase-9 (9502, 1:1000). The following antibodies diluted in 5% milk were used for stripped membranes: mouse monoclonal antibody directed against cytokeratin 18 (1:1500; Sigma, St. Louis, MO) and GAPDH (1:5000; Chemicon, Temecula, CA).…”

“…13,14 Previously, we showed that the endogenous caspase-8 inhibitor, cellular Fas-associated death domain (FADD)-like interleukin-1␤-converting enzyme-like inhibitory protein (c-FLIP), is expressed by RPE cells and that protein levels are increased in an NF-B-dependent manner after TNF-␣ stimulation. 12,15 It is thought that the relative abundance of c-FLIP to caspase-8 determines whether caspase-8 is activated. 16 Our data showing that RPE cells do not die, even when NF-B is inhibited, suggested that an extrinsic apoptotic signaling component maybe functionally reduced.…”

Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE

“…19 RPE/choroid-derived RNA was isolated using the same methods and further treated to remove visible melanin contamination as previously described. 20 RPE-enriched RNA was prepared from RPE cells carefully brushed off the posterior cup and processed as previously described. 20 RNA quality was verified on a 0.8% agarose gel and by real-time quantitative RT-PCR (qRT-PCR) analysis of known tissuespecific genes.…”

“…20 RPE-enriched RNA was prepared from RPE cells carefully brushed off the posterior cup and processed as previously described. 20 RNA quality was verified on a 0.8% agarose gel and by real-time quantitative RT-PCR (qRT-PCR) analysis of known tissuespecific genes. 19,21 …”