Human insulin gene expression in transgenic mice: mutational analysis of the regulatory region

Itier, Jean-Michel; Douhet, Philippe; Desbois, Pierrette; Joshi, Rajiv L.; Dandoy-Dron, Françoise; Jami, Jacques; Bucchini, Danielle

doi:10.1046/j.1432-0436.1996.6050309.x

Cited by 8 publications

(6 citation statements)

References 36 publications

(90 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It contains important regulatory motifs (Fig. 1a) previously used to make reporters for identifying INS + cells [6], [12]. We first confirmed the utility of this region to report insulin production by transfecting a phINS-EGFP construct (Fig.…”

Section: Resultssupporting

confidence: 55%

A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines

et al. 2012

View full text Add to dashboard Cite

Many research studies use immortalized cell lines as surrogates for primary beta- cells. We describe the production and use of a novel “indirect" dual-fluorescent reporter system that leads to mutually exclusive expression of EGFP in insulin-producing (INS+) beta-cells or mCherry in non-beta-cells. Our system uses the human insulin promoter to initiate a Cre-mediated shift in reporter color within a single transgene construct and is useful for FACS selection of cells from single cultures for further analysis. Application of our reporter to presumably clonal HIT-T15 insulinoma cells, as well as other presumably clonal lines, indicates that these cultures are in fact heterogeneous with respect to INS+ phenotype. Our strategy could be easily applied to other cell- or tissue-specific promoters. We anticipate its utility for FACS purification of INS+ and glucose-responsive beta-like-cells from primary human islet cell isolates or in vitro differentiated pluripotent stem cells.

show abstract

Section: Resultssupporting

confidence: 55%

A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines

et al. 2012

View full text Add to dashboard Cite

show abstract

“…Interestingly, systematic in vitro binding studies and episomal reporter assays have disclosed >16 binding activities and functional elements in the human insulin promoter, yet did not highlight the critical role of the CC sequence prior to the human genetic findings 4,[22][23][24][25][26] . A mutation of a 34 bp region that contains the CC element in randomly integrated human INS promoter transgenics did not significantly alter promoter activity 54 . This indicates that the essential function of the CC element to create active chromatin can only become fully apparent in a natural chromatinized environment, such as that of human patients or mutant HIP mice.…”

Section: Discussionmentioning

confidence: 88%

Neonatal diabetes mutations disrupt a chromatin pioneering function that activates the human insulin gene

Akerman

Maestro

Grau

et al. 2020

Preprint

View full text Add to dashboard Cite

Despite the central role of chromosomal context in gene transcription, human noncoding DNA variants are generally studied outside of their endogenous genomic location. This poses major limitations to understand the true consequences of causal regulatory variants. We focused on a cis-regulatory mutation (c.-331C>G) in the INS gene promoter that is recurrently mutated in unrelated patients with recessive neonatal diabetes. We created mice in which a ~3.1 kb human INS upstream region carrying -331C or -331G alleles replaced the orthologous mouse Ins2 region. This human sequence drove cell-specific transcription in mice. It also recapitulated poised chromatin during pancreas development and active chromatin in differentiated bcells. The c.-331C>G mutation, however, blocked active chromatin formation in differentiated b-cells. We further show that another neonatal diabetes gene product, GLIS3, had a singular pioneer-like ability to activate INS chromatin in non-pancreatic cells, which was hampered by the c.-331C>G mutation. This in vivo analysis of human regulatory defects, therefore, uncovered cis and trans components of a mechanism that is essential to activate the endogenous INS gene.

show abstract

“…pCAGRm was constructed by replacing a DNA fragment encoding the EYFP protein of pCAGYm with a Bam HI– Not I fragment encoding the DsRed1 protein of pDsRed1‐N1. pInsG was constructed by inserting a insulin enhancer/promoter (−363 to +15) [28], which was obtained by polymerase chain reaction from a healthy human volunteer using the forward primer: 5′‐GACAGCAGCGCAAAGAGCCCCGCCCTGC‐3′ and the reverse primer: 5′‐CTGTCCTGGAGGGCTGAGGGCTGCTGGG‐3′, into the Ase I and Sac II sites of pEGFP‐N1 (Clontech, USA). pCAGRm‐InsG and pCAGRm‐InsG(R) were constructed by inserting a 1.3 kb Spe I– Afl II fragment of pInsG into the Hin dIII site of pCAGRm.…”

Section: Methodsmentioning

confidence: 99%

Insulators prevent transcriptional interference between two promoters in a double gene construct for transgenesis

Hasegawa

Nakatsuji

2002

FEBS Letters

View full text Add to dashboard Cite

In transgenesis, the expression of two transgenes is often subject to mutual interference by each of the two expression cassettes when they are driven by different transcriptional regulatory elements in a single construct. To study this problem, we constructed vectors consisting of two expression units, one contains a strong ubiquitous promoter and the other contains a tissue-specific transcriptional element. The expression pattern of each transgene was examined in transfected cell lines and also in transgenic mice. In both cases, two expression units in a single construct were expressed in an independent manner and were controlled by their respective regulatory element only if we placed insulators at both ends of one expression unit. These results indicate that usage of insulators is a valuable tool for transfection of double gene constructs in transgenesis. ß

show abstract

Human insulin gene expression in transgenic mice: mutational analysis of the regulatory region

Cited by 8 publications

References 36 publications

A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines

A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines

Neonatal diabetes mutations disrupt a chromatin pioneering function that activates the human insulin gene

Insulators prevent transcriptional interference between two promoters in a double gene construct for transgenesis

Contact Info

Product

Resources

About