Human Induced Pluripotent Stem Cell-Derived TDP-43 Mutant Neurons Exhibit Consistent Functional Phenotypes Across Multiple Gene Edited Lines Despite Transcriptomic and Splicing Discrepancies

Abstract

Gene editing technologies hold great potential to enhance our ability to model inheritable neurodegenerative diseases. Specifically, engineering multiple amyotrophic lateral sclerosis (ALS) mutations into isogenic cell populations facilitates determination of whether different causal mutations cause pathology via shared mechanisms, and provides the capacity to separate these mechanisms from genotype-specific effects. As gene-edited, cell-based models of human disease become more commonplace, there is an urgent need to verify that these models constitute consistent and accurate representations of native biology. Here, commercially sourced, induced pluripotent stem cell-derived motor neurons from Cellular Dynamics International, edited to express the ALS-relevant mutations TDP-43M337V and TDP-43Q331K were compared with in-house derived lines engineered to express the TDP-43Q331K mutation within the WTC11 background. Our results highlight electrophysiological and mitochondrial deficits in these edited cells that correlate with patient-derived cells, suggesting a consistent cellular phenotype arising from TDP-43 mutation. However, significant differences in the transcriptomic profiles and splicing behavior of the edited cells underscores the need for careful comparison of multiple lines when attempting to use these cells as a means to better understand the onset and progression of ALS in humans.

Human fetal membrane-mesenchymal stromal cells generate functional spinal motor neurons in vitro

“…Moreover, the increased expression over time of proteins related to the synthesis and transport of the ACh, such as ChAT or VAChT and SV2 suggests a progressive improvement of the neurotransmission capacity that would require 40–50 days to be efficient. The firing rate that we detected in hFM-MSC-derived MNs even if not particularly high, was still comparable to that observed in hiPSC-derived MNs ( Smith et al., 2021 ; Thiry et al., 2022 ); but lower than that recorded in hiPSC-derived MNs co-cultured with astrocytes or in vivo (MNs isolated from animal spinal cord) ( Carp et al., 2008 ; Taga et al., 2019 ): this finding probably reflects the absence in our system of neurotrophic influences from glial cells or of the neuro-modulatory activity from afferent or descending inputs. In contrast with MEA studies utilizing cortical neurons ( Odawara et al., 2018 ; Di Credico et al., 2021 ), we did not detect the formation of physiologically relevant neural networks among spinal cord hFM-MSC-derived MNs.…”

High-throughput, real-time monitoring of engineered skeletal muscle function using magnetic sensing

“…Working with the University of Washington’s Institute for Stem Cell and Regenerative Medicine Ellison Stem Cell Core, dystrophin-null genotypes were engineered into the UC3-4 normal line using methods described previously. 25 , 26 Cas9 guide RNAs (gRNA) targeting the DMD locus were designed using CRISPoR. Three gRNA were chosen, targeting intron 44 (AAAAACTGGAGCTAACCGAG), intron 45 (ATATACTTGTGGCTAGTTAG), and exon 54 (TGGCCAAAGACCTCCGCCAG) ( Supplemental Figure S1A ).…”

High-throughput, real-time monitoring of engineered skeletal muscle function using magnetic sensing

“…Working with the University of Washington’s Institute for Stem Cell and Regenerative Medicine Ellison Stem Cell Core, dystrophin-null genotypes were engineered into the UC3-4 wild type line using methods described previously 25, 26 . Cas9 guide RNAs (gRNA) targeting the DMD locus were designed using CRISPoR.…”