Human granulocytic anaplasmosis in a Single University Hospital in the Republic of Korea

Abstract

To date, only a few studies have analyzed the clinical characteristics and genetic features of human granulocytic anaplasmosis (HGA) in South Korea. Thus, in this study, we investigated the clinical characteristics of HGA and methods used for clinical diagnosis. The clinical characteristics of patients with HGA were studied retrospectively. We reviewed the medical charts of 21 confirmed patients with HGA admitted to the Chosun University Hospital, located in Gwangju, South Korea. Twenty-one HGA patients visited the hospital 2–30 days (median 7 days) after the onset of symptoms. Fourteen patients (66.7%) had fever, which was alleviated 2 h (range 0–12.75 h) after starting treatment with doxycycline. Of the 18 patients who underwent peripheral blood (PB) smear test, only one (5.6%) had morulae. Additionally, only 4/17 patients (23.5%) had morulae in the PB smear reconducted after the confirmation of anaplasmosis. All 21 patients recovered without significant complications. As per results of the blood tests conducted at the time of admission, 7/21 (33.3%) and 5/21 (23.8%) patients showed at least 1:16 and 1:80 of IgM and IgG titers, respectively. Most HGA patients in Korea recovered without significant complications. The indirect immunofluorescence antibody diagnosis or morulae identification for HGA in this study had low sensitivity in the early stage of the disease.

Clinically differential diagnosis of human granulocytic anaplasmosis and severe fever with thrombocytopenia syndrome

“…The data on 221 patients who received a diagnosis of SFTS at 21 hospitals in Korea and 33 patients who received a diagnosis of HGA at the Chosun University Hospital from 2013 to 2020 were analyzed and compared 17 , 20 .…”

Molecular identification of Anaplasma platys in cattle by nested PCR

“…Gel electrophoresis results have shown that the 16S rRNA gene exists in 24 samples. This identification enables confirmation of the organism as A. platys according to Bakken (19). Phylogenetic tree analysis.…”

“…Normal and nested PCR were used in this study for diagnosis of A. platys. Two sets of primers (EE-1, EE-2, EE-3, and EE-4) were used to detect and amplify the targeting partial region of 16S rRNA (19). Interestingly, these primers were used in previous work to detect A. Phagocytophiulm before the deposition of the A. platys sequence.…”

“…Similar conditions were used in the second round using 1 µl from the product of the first round and internal primers targeting the 16S rRNA gene to amplify 926 bp region including EE-3 5' GTCGAAC-GGATTATTCTTTATAGCTTGC 3' and EE-4 5' CCCTTCCGTTAAGAAGGATCTAATCTCC 3' (19). The generated PCR products were analysed by agarose gel electrophoresis and stained with ethidium bromide.…”

Heavy metals in Landfill Leachate and e-Waste Dumping Sites and its adverse effect.

“…We have discussed all the possible land ll metals [26][27][28][29][30][31] and its environmental as well as health effects. Therefore, the review can give information regarding the hazardous metals which can present in land ll and came in the natural stream and creates health hazardous effect to the living being.…”