Human dopamine transporter gene (DAT1) maps to chromosome 5p15.3 and displays a VNTR

Vandenbergh, David J.; Persico, Antonio M.; Hawkins, Anita L.; Griffin, Constance A.; Li, Xiang; Jabs, Ethylin Wang; Uhl, George R.

doi:10.1016/s0888-7543(05)80138-7

Cited by 643 publications

(478 citation statements)

References 14 publications

Supporting

Mentioning

460

Contrasting

Unclassified

Order By: Relevance

“…All the genotyping was carried out as previously described (Vandenbergh et al. 1992). PCR amplification was performed using the primers (DATVNTRF: 5′‐TGTGGTGTAGGGAACGGCCTGAG‐3′ and DATVNTRR: 5′‐CTTCCTGGAGGTCACGGCTCAAGG‐3′) as reported previously (Vandenbergh et al.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Using iPSC‐derived human DA neurons from opioid‐dependent subjects to study dopamine dynamics

et al. 2016

View full text Add to dashboard Cite

IntroductionThe dopaminergic (DA) system plays important roles in addiction. However, human DA neurons from drug‐dependent subjects were not available for study until recent development in inducible pluripotent stem cells (iPSCs) technology.MethodsIn this study, we produced DA neurons differentiated using iPSCs derived from opioid‐dependent and control subjects carrying different 3′ VNTR (variable number tandem repeat) polymorphism in the human dopamine transporter (DAT or SLC6A3). In addition, the effects of valproic acid (VPA) exposures on iPSC‐derived human DA neurons are also examined.ResultsWe present the first evidence suggesting that the 3′ VNTR polymorphism in the hDAT gene affects DAT expression level in iPSC‐derived human DA neurons. In human DA neurons, which provide an appropriate cellular milieu, VPA treatment alters the expression of several genes important for dopaminergic neuron function including DAT, Nurr1, and TH; this might partly explain its action in regulating addictive behaviors. VPA treatment also significantly increased DA D2 receptor (Drd2) expression, especially in the opioid‐dependent iPSC cell lines.ConclusionsOur data suggest that human iPSC‐derived DA neurons may be useful in in vitro experimental model to examine the effects of genetic variation in gene regulation, to examine the underlying mechanisms in neurological disorders including drug addiction, and to serve as a platform for therapeutic development.

show abstract

Section: Methodsmentioning

confidence: 99%

“…PCR amplification was performed using the primers (DATVNTRF: 5′‐TGTGGTGTAGGGAACGGCCTGAG‐3′ and DATVNTRR: 5′‐CTTCCTGGAGGTCACGGCTCAAGG‐3′) as reported previously (Vandenbergh et al. 1992). …”

Section: Methodsmentioning

confidence: 99%

Using iPSC‐derived human DA neurons from opioid‐dependent subjects to study dopamine dynamics

et al. 2016

View full text Add to dashboard Cite

show abstract

“…88 A 40-bp VNTR polymorphism (3-13 repeats) has been identified in the 3 0 -untranslated region (UTR) of SCL6A3 encoding DAT1. 89,90 The SCL6A3-9-and 10-repeat alleles occur most frequently in humans, 91,92 but their functional impacts are unclear. 88,93 The SLC6A3-9 allele has been associated with a lower risk of current smoking and starting smoking before age 16 years, longer periods of abstinence during previous quit attempts and increased quitting.…”

Section: Dopamine Transportermentioning

confidence: 99%

Overview of the pharmacogenomics of cigarette smoking

Tyndale

2007

Pharmacogenomics J

102

View full text Add to dashboard Cite

Cigarette smoking increases the risk of numerous health problems, including cancer, cardiovascular and pulmonary disorders, making smoking the leading cause of preventable death in the world. Nicotine is primarily responsible for the highly addictive properties of cigarettes. Although the majority of smokers express a desire to quit, few are successful in doing so. Twin and family studies have indicated substantial genetic contributions to smoking behaviors. One major research focus has been to elucidate the specific genes involved; this has been accomplished primarily through genome-wide linkage analyses and candidate gene association studies. Much attention has focused on genes involved in the neurotransmitter pathways for the brain reward system and genes altering nicotine metabolism. This paper reviews the current state of knowledge for genetic factors implicated in smoking behaviors, and examines how genetic variations may affect therapeutic outcomes for drugs used to assist smoking cessation.

show abstract

“…The gene coding for the DAT (SLC6A3; OMIM 126455) is located on chromosome 5p15.3 and includes a variable number of tandem repeats (VNTR) polymorphism of a 40 base-pair sequence in the 3 0 -untranslated region (3 0 -UTR). The most common polymorphisms are the 9/10 and 10/10 forms (Vandenbergh et al, 1992).…”

Section: Introductionmentioning

confidence: 99%

Methylphenidate Effects on Brain Activity as a Function of SLC6A3 Genotype and Striatal Dopamine Transporter Availability

Kasparbauer

Rujescu²,

Riedel

et al. 2014

Neuropsychopharmacol

View full text Add to dashboard Cite

We pharmacologically challenged catecholamine reuptake, using methylphenidate, to investigate its effects on brain activity during a motor response inhibition task as a function of the 3 0 -UTR variable number of tandem repeats (VNTR) polymorphism of the dopamine transporter (DAT) gene (SLC6A3) and the availability of DATs in the striatum. We measured the cerebral hemodynamic response of 50 healthy males during a Go/No-Go task, a measure of cognitive control, under the influence of 40 mg methylphenidate and placebo using 3T functional magnetic resonance imaging. Subjects were grouped into 9-repeat (9R) carriers and 10/10 homozygotes on the basis of the SLC6A3 VNTR. During successful no-go trials compared with oddball trials, methylphenidate induced an increase of blood oxygen level-dependent (BOLD) signal for carriers of the SLC6A3 9R allele but a decrease in 10/10 homozygotes in a thalamocortical network. The same pattern was observed in caudate and inferior frontal gyrus when successful no-go trials were compared with successful go trials. We additionally investigated in a subset of 35 participants whether baseline striatal DAT availability, ascertained with 123 I-FP-CIT single photon emission computed tomography, predicted the amount of methylphenidate-induced change in hemodynamic response or behavior. Striatal DAT availability was nominally greater in 9R carriers compared with 10/10 homozygotes (d ¼ 0.40), in line with metaanalyses, but did not predict BOLD or behavioral changes following MPH administration. We conclude that the effects of acute MPH administration on brain activation are dependent on DAT genotype, with 9R carriers showing enhanced BOLD following administration of a prodopaminergic compound.

show abstract

Human dopamine transporter gene (DAT1) maps to chromosome 5p15.3 and displays a VNTR

Cited by 643 publications

References 14 publications

Using iPSC‐derived human DA neurons from opioid‐dependent subjects to study dopamine dynamics

Using iPSC‐derived human DA neurons from opioid‐dependent subjects to study dopamine dynamics

Overview of the pharmacogenomics of cigarette smoking

Methylphenidate Effects on Brain Activity as a Function of SLC6A3 Genotype and Striatal Dopamine Transporter Availability

Contact Info

Product

Resources

About