Human C.hivin.1 inhibitor: primary structure, cDNA cloning, and chromosomal localization

Abstract

The primary structure of human C1 inhibitor was determined by peptide and DNA sequencing. The single-chain polypeptide moiety of the intact inhibitor is 478 residues (52,869 Da), accounting for only 51% of the apparent molecular mass of the circulating protein (104,000 Da). The positions of six glucosamine-based and five galactosamine-based oligosaccharides were determined. Another nine threonine residues are probably also glycosylated. Most of the carbohydrate prosthetic groups (probably 17) are located at the amino-terminal end (residues 1-120) of the protein and are particularly concentrated in a region where the tetrapeptide sequence Glx-Pro-Thr-Thr, and variants thereof, is repeated 7 times. No phosphate was detected in C1 inhibitor. Two disulfide bridges connect cysteine-101 to cysteine-406 and cysteine-108 to cysteine-183. Comparison of the amino acid and cDNA sequences indicates that secretion is mediated by a 22-residue signal peptide and that further proteolytic processing does not occur. C1 inhibitor is a member of the large serine protease inhibitor (serpin) gene family. The homology concerns residues 120 through the C-terminus. The sequence was compared with those of nine other serpins, and conserved and nonconserved regions correlated with elements in the tertiary structure of alpha 1-antitrypsin. The C1 inhibitor gene maps to chromosome 11, p11.2-q13. C1 inhibitor genes of patients from four hereditary angioneurotic edema kindreds do not have obvious deletions or rearrangements in the C1 inhibitor locus. A HgiAI DNA polymorphism, identified following the observation of sequence variants, will be useful as a linkage marker in studies of mutant C1 inhibitor genes.

Five novel mutations in the C1 inhibitor gene (C1NH) leading to a premature stop codon in patients with type I hereditary angioedema

“…d 3' primer: 5' tttcttatgaccttaacccgt 3'; 5' primer and PCR conditions were the same as for cycle sequencing (see Table 1) but Tan = 56 o C and Mg 2+ = 1.5 mmol/l. Three known polymorphisms, g.566T/C in exon 2, g.14011a/g in intron 6 and p.V458M in exon 8 (Verpy et al, 1996;Pappalardo et al, 2000;Bock et al, 1986), were also detected. The additional polymorphism in intron 4, g.4573g/a described by Verpy et al, 1996, could not be detected with the amplification primers used in this work.…”

Molecular modeling of protein-glycosaminoglycan interactions.

“…62 Harper and Lobb 42 recently reported that reductive methylation of less than three lysines in acidic fibroblast growth factor (FGF) significantly reduced its heparin affinity, growth factor receptor affinity, and ability to stimulate mitogenesis in Balb/C 3T3 fibroblasts. Lys-118 was the primary site of dimethylation, and Lys-118 and -112 were the major sites of monomethylation.…”

The Functional Integrity of the Serpin Domain of C1-inhibitor Depends on the Unique N-terminal Domain, as Revealed by a Pathological Mutant

“…PCR and subcloning for production of the N-terminal deletion mutants in Pichia pastoris was performed as described. Primers were designed that started at amino acid 76, 98, and 115 of C1-Inh according to the numbering of Bock et al (41) and enabled subcloning of the mutant gene in the plasmid for expression and secretion by P. pastoris. Transformation of the P. pastoris strain GS115 and C1-Inh expression were performed as described before (51).…”

“…Many A/C-rich direct repeats of up to 11 nucleotides are present, which may have caused the deletion to occur. In addition, it contains Cys 101 and Cys 108 , which connect the N-terminal domain to the serpin domain by forming disulfide bridges with Cys 183 and Cys 406 (41). This deletion of 165 base pairs predicted a deletion of 55 amino acids of the N-terminal non-serpin domain, including two cysteines involved in the formation of the two disulfide bridges of the molecules.…”

“…Two disulfide bridges linking cysteine 101 to cysteine 406 and cysteine 108 to cysteine 183 connect the N-terminal to the serpin domain (41). Reduction of these disulfide bonds in the intact serpin reduces its conformational stability and induces a latent conformation by auto-insertion of the reactive site loop into the central A ␤-sheet (42).…”