Human apolipoprotein B: identification of cDNA clones and characterization of mRNA

160

Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias.

Section: Resultssupporting

confidence: 89%

mentioning

confidence: 98%

Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

Law¹,

Grant²,

Higuchi³

et al. 1986

160

“…Indeed, our preliminary findings suggest the presence of additional sequences hybridizing with apoC1 cDNA in the APOCI/APOC2/APOE cluster. We have recently identified cDNA clones for human apoB, and examination of a somatic cell panel indicates that APOB resides on human chromosome 2, unlinked to any of the three previously identified apolipoprotein loci (57,58).…”

Section: Discussionmentioning

confidence: 99%

Regional mapping of human chromosome 19: organization of genes for plasma lipid transport (APOC1, -C2, and -E and LDLR) and the genes C3, PEPD, and GPI.

Lusis¹,

Heinzmann²,

Sparkes³

et al. 1986

We report the regional mapping of human chromosome 19 genes for three apolipoproteins and a lipoprotein receptor as well as genes for three other markers. The regional mapping was made possible by the use of a reciprocal whole-arm translocation between the long arm of chromosome 19 and the short arm of chromosome 1. Examination of three separate somatic cell hybrids containing the long arm but not the short arm of chromosome 19 indicated that the genes for apolipoproteins CI, CII, and E (APOCI, APOC2, and APOE, respectively) and glucose-6-phosphate isomerase (GPI) reside on the long arm, whereas genes for the low density lipoprotein receptor (LDLR), complement component 3 (C3), and peptidase D (PEPD) reside on the short arm. When taken together with previous studies, our results suggest the following physical gene map: pter-LDLR-C3-pl3.2-PEPD-centromere-(APOE, APOCI, APOC2, GPI)-qter. In addition, we have isolated a single A phage carrying both APOCI and part ofAPOE. These genes are tandemly oriented and are separated by about 6 kilobases of genomic DNA. Since previous family studies indicate tight linkage of APOE and APOC2, the apolipoprotein genes APOCI, APOC2, and APOE form a tight complex on the long arm of chromosome 19, suggesting the possibility of coordinate regulation.

“…Progress in elucidating the structure of apoB is being made through the characterization of cDNA clones. Several groups (8)(9)(10)(11)(12)(13)(14)(15) have presented human or rat liver cDNA clones representing a part of the apoB mRNA. Knott et al (9) have described human liver cDNA clones that code for the 1455 carboxyl-terminal amino acids.…”

Section: (4)mentioning

confidence: 99%

Analysis of cDNA clones encoding the entire B-26 region of human apolipoprotein B.

Protter¹,

Hardman²,

Sato³

et al. 1986

We report the characterization of intestine and liver cDNA clones for human apolipoprotein B (apoB) that map to the 5' end of the mRNA. The protein sequence encoded by the 5011 nucleotides derived from sequence analysis of these clones includes 1643 amino acid residues of the mature protein ofMr 184,000. The amino acid sequence at the amino terminus of B-74 peptide was determined and mapped to residue 1298. The size (Mr 145,700) and amino acid composition of the B-26 region encoded by these clones (including amino acid residues 1-1297) closely match the values obtained from the B-26 peptide.The amino acid sequence of psptide B-100 at the junction of peptides B-26 and B-74 (Phe-Lys-Ser) shows structural homology to the site on human kininogen (Phe-Arg-Ser) (4).Two immunochemically related forms ofhuman apoB, B-100 (Mr 550,000) and B-48 (Mr 280,000), have been described (5), each with its own principal metabolic pathway. The B-48 form of apoB is secreted from the intestinal epithelium into the mesenteric lymph in chylomicrons (2). The B-100 form ofapoB is secreted from the liver associated initially with VLDL, and then, after processing of the particle in the blood, with LDL.' Although the exact relationship between B-100 and B-48 is not known, various immunological and structural studies indicate that the two forms have some homology (2).Two additional plasma forms of apoB, B-74 (Mr 407,000) and B-26 (Mr 144,000), have also been described (5). Amino acid composition data suggest that peptides B-74 and B-26 are fragments of B-100. Fragments of similar molecular weight to those of B-74 and B-26 can be obtained in vivo by treating LDL with the proteolytic enzyme plasma kallikrein (6, 7). Recent studies (8) have mapped the B-26 fragment to the amino terminus of B-100. The precise mechanism by which these two apoB peptides are formed in the blood and their physiological significance is not known. Progress in elucidating the structure of apoB is being made through the characterization of cDNA clones. Several groups (8-15) have presented human or rat liver cDNA clones representing a part of the apoB mRNA. Knott et al. (9) have described human liver cDNA clones that code for the 1455 carboxyl-terminal amino acids. We have presented the sequence of a human liver cDNA clone that includes part of the 5' nontranslated region, the signal peptide, and 350 amino acids from the amino terminus (8). In this report we extend the characterization of B-100 protein encoded by cDNA clones of both the liver and the intestine. The 5010 base pairs analyzed code for the amino-terminal 1643 amino acids of B-100.MATERIALS AND METHODS Materials. The 21-base oligonucleotide probe B 1147, CAGCCGCTTCTllTGGTGAAGG, the 22-base oligonucleotide probe B 1254, TCCTCCAGAAGTCTAAAGATGT, and other 17-base oligonucleotides that were used for sequence analysis were prepared as described (8). Radioisotopes were from Amersham, and all restriction enzymes were from New England Biolabs.Purification and Sequence Analysis of B-74 and Fragments of B-26...