HP1 modulates the transcription of cell-cycle regulators in 
            <i>Drosophila melanogaster</i>

Lucia, Filomena De; Ni, Jian-Quan; Vaillant, Catherine; Sun, Fang-Lin

doi:10.1093/nar/gki584

Cited by 79 publications

(85 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1360 is a repetitive sequence found most abundantly in constitutive heterochromatin regions of all Drosophila chromosomes and is believed to be essential for initiating heterochromatin formation 15,16 . Enrichment of HP1 binding to 1360 sequences has been detected previously by ChIP 17 . We found that association of HP1 with 1360 was significantly reduced following stat92E RNAi knockdown (Fig.…”

supporting

confidence: 52%

“…Oligonucleotides used to amplify the 1360 transposon (forward: TGTATCGTTTTTAAAAAATTGTCAG; reverse: GTGGACCTGTAATATATGCTCT) were as described 17 . A 500-bp stat92E cDNA fragment was amplified by T7 promoter attached to PCR primers (forward: GAAT TAATACGACTCACTATAGGGAGACTTGCCCAAAACTACAGTTAC; reverse: GAATTAATACGACTCACTATAGGGAGACGACTGTGGGTGGATTGTT) and used for stat92E RNAi synthesis by in vitro transcription with the Fermentas T7 RNA transcription kit, according to the manufacturer's instruction.…”

Section: Cell Culture Oligonucleotides and Plasmidsmentioning

confidence: 99%

See 1 more Smart Citation

Drosophila STAT is required for directly maintaining HP1 localization and heterochromatin stability

et al. 2008

View full text Add to dashboard Cite

STAT (Signal transducer and activator of transcription) is a potent transcription factor and its aberrant activation by phosphorylation is associated with human cancers [1][2][3][4] . We have shown previously that overactivation of JAK, which phosphorylates STAT 5,6 , disrupts heterochromatin formation globally in Drosophila melanogaster 7 . However, it remains unclear how this effect is mediated and whether STAT is involved. Here, we demonstrate that Drosophila STAT (STAT92E) is involved in controlling heterochromatin protein 1 (HP1) distribution and heterochromatin stability. We found, unexpectedly, that loss of STAT92E, had the same effects as overactivation of JAK in disrupting heterochromatin formation and heterochromatic gene silencing, whereas overexpression of STAT92E had the opposite effects. We have further shown that the unphosphorylated or 'transcriptionally inactive' form of STAT92E is localized on heterochromatin in association with HP1, and is required for stabilizing HP1 localization and histone H3 Lys 9 methylation (H3mK9). However, activation by phosphorylation reduces heterochromatin-associated STAT92E, causing HP1 displacement and heterochromatin destabilization. Thus, reducing levels of unphosphorylated STAT92E, either by loss of STAT92E or increased phosphorylation, causes heterochromatin instability. These results suggest that activation of STAT by phosphorylation controls both access to chromatin and activity of the transcription machinery.To understand the molecular mechanism underlying JAK/STAT-mediated tumour formation, we have previously investigated the role of JAK in a Drosophila leukaemia model, in which a hyperactive mutant form of JAK (Tum-1) causes leukaemia-like overproliferation of blood cells 5,8 . We have demonstrated that oncogenic JAK disrupts heterochromatin formation globally, allowing transcriptional activation of genes that are not necessarily direct targets of STAT 7,9 . The molecular mechanism underlying the effects of Hopscotch (Hop, Drosophila JAK) on heterochromatin remains unclear. It may be mediated by phosphorylation of STAT92E, as in the canonical JAK/STAT pathway 10,11 . Alternatively, Hop may activate cellular targets other than STAT92E 9 .To investigate whether disruption of heterochromatin induced by Hop-activation 7 is mediated by STAT92E, we examined the effects of reducing stat92E + dosage on heterochromatic gene silencing, which can be measured by position-effect variegation (PEV) 12 We next examined the epistatic relationship between HP1 and STAT92E ( Fig. 1d-k). HP1, encoded by Su(var)205, is a constitutive component of heterochromatin and is essential for heterochromatic gene silencing 12,13 . Consistent with the results described above, we found that increasing stat92E + dosage by a chromosomal duplication (referred to as 3 × stat92E + , Fig. 1f) or a stat92E + transgene ( Supplementary Information, Fig. S1) enhanced heterochromatic gene silencing, resulting in complete silencing of the variegated white + gene. This effect was antagonized,...

show abstract

supporting

confidence: 52%

Section: Cell Culture Oligonucleotides and Plasmidsmentioning

confidence: 99%

Drosophila STAT is required for directly maintaining HP1 localization and heterochromatin stability

et al. 2008

View full text Add to dashboard Cite

show abstract

“…Chromatin precipitated by MYC-PIWI antibodies was recovered and the DNA was assayed by real-time PCR to quantify the association of MYC-PIWI with the F and 1360 elements-two transposable elements known to be preferentially bound by HP1a (De Lucia et al 2005). MYC-PIWI is enriched at F and 1360 elements 2.8-and 2.0-fold, respectively, over the housekeeping gene rpL32 (Fig.…”

Section: Piwi Colocalizes With Hp1a At Many Chromosomal Sitesmentioning

confidence: 99%

Drosophila PIWI associates with chromatin and interacts directly with HP1a

Brower-Toland¹,

Findley²,

Jiang³

et al. 2007

Genes Dev.

317

297

View full text Add to dashboard Cite

The interface between cellular systems involving small noncoding RNAs and epigenetic change remains largely unexplored in metazoans. RNA-induced silencing systems have the potential to target particular regions of the genome for epigenetic change by locating specific sequences and recruiting chromatin modifiers. Noting that several genes encoding RNA silencing components have been implicated in epigenetic regulation in Drosophila, we sought a direct link between the RNA silencing system and heterochromatin components. Here we show that PIWI, an ARGONAUTE/PIWI protein family member that binds to Piwi-interacting RNAs (piRNAs), strongly and specifically interacts with heterochromatin protein 1a (HP1a), a central player in heterochromatic gene silencing. The HP1a dimer binds a PxVxL-type motif in the N-terminal domain of PIWI. This motif is required in fruit flies for normal silencing of transgenes embedded in heterochromatin. We also demonstrate that PIWI, like HP1a, is itself a chromatin-associated protein whose distribution in polytene chromosomes overlaps with HP1a and appears to be RNA dependent. These findings implicate a direct interaction between the PIWI-mediated small RNA mechanism and heterochromatin-forming pathways in determining the epigenetic state of the fly genome.[Keywords: PIWI; ARGONAUTE; HP1; heterochromatin; epigenetic; RNAi] Supplemental material is available at http://www.genesdev.org. . In TGS, small RNAs are incorporated into specialized effector complexes able to regulate chromatin modification, resulting in reduced access for the transcriptional machinery to chromatin. The TGS system that contributes to initiation and maintenance of heterochromatin formation in Schizosaccharomyces pombe is particularly well characterized (Verdel and Moazed 2005;Grewal and Jia 2007). In S. pombe, the RNA silencing system targets histone 3 Lys 9 (H3K9) methylation and recruits HP1 homolog Swi6 to the MAT locus and to repetitive elements in pericentric heterochromatin, setting up a heterochromatin spreading/maintenance loop that is dependent on the interaction of Swi6 with the Clr4 histone methyltransferase (HMT) (Grewal and Jia 2007). In plants, a specialized small RNA pathway utilizes heterochromatic RNAs to direct DNA methylation and presumably other chromatin modifications to effect silencing of target loci (for review, see Vaucheret 2007). In Caenorhabditis elegans, a single episode of RNA interference (RNAi) exposure can induce silencing inherited over many generations; mutations that abolish inheritance are all involved in chromatin structure, suggesting a chromatin-based mechanism (Vastenhouw et al. 2006). While the work in fission yeast and plants provides a possible paradigm for RNAi-dependent TGS in metazoans, a specialized TGS effector complex has not yet been characterized in an animal.

show abstract

“…These include Drosophila HP1a, which is required for proper expression of most heterochromatic genes as well as a few euchromatic genes (Hearn et al 1991;Clegg et al 1998;Lu et al 2000;Piacentini et al 2003;Cryderman et al 2005;De Lucia et al 2005). Mammalian HP1␥ has also been shown to localize at active genes in a murine erythroid cell line (Vakoc et al 2005).…”

Section: The Contribution Of Hp1c To Gene Expressionmentioning

confidence: 99%

“…It is uncertain whether this general picture applies to all HP1 proteins and possible scenarios. Actually, Drosophila HP1a is known to play a more complex role(s) in the regulation of gene expression, as it is required for the expression of several heterochromatic genes (Hearn et al 1991;Clegg et al 1998;Lu et al 2000), and certain euchromatic genes (Cryderman et al 2005;De Lucia et al 2005). Moreover, Drosophila HP1a is recruited to developmentally regulated genes and heat-shock-induced puffs in an RNA-dependent manner , and in an erythroid cell line, murine HP1␥ was found associated to actively transcribed genes (Vakoc et al 2005).…”

mentioning

confidence: 99%

Drosophila HP1c isoform interacts with the zinc-finger proteins WOC and Relative-of-WOC to regulate gene expression

Font-Burgada¹,

Rossell²,

Auer³

et al. 2008

Genes Dev.

129

View full text Add to dashboard Cite

Heterochromatin protein 1 (HP1) proteins are conserved in eukaryotes, with most species containing several isoforms. Based on the properties of Drosophila HP1a, it was proposed that HP1s bind H3K9me2,3 and recruit factors involved in heterochromatin assembly and silencing. Yet, it is unclear whether this general picture applies to all HP1 isoforms and functional contexts. Here, we report that Drosophila HP1c regulates gene expression, as (1) it localizes to active chromatin domains, where it extensively colocalizes with the poised form of RNApolymerase II (RNApol II), Pol IIo ser5 , and H3K4me3, suggesting a contribution to transcriptional regulation; (2) its targeting to a reporter gene does not induce silencing but, on the contrary, increases its expression, and (3) it interacts with the zinc-finger proteins WOC (without children) and Relative-of-WOC (ROW), which are putative transcription factors. Here, we also show that, although HP1c efficiently binds H3K9me2,3 in vitro, its binding to chromatin strictly depends on both WOC and ROW. Moreover, expression profiling indicates that HP1c, WOC, and ROW regulate a common gene expression program that, in part, is executed in the context of the nervous system. From this study, which unveils the essential contribution of DNA-binding proteins to HP1c functionality and recruitment, HP1 proteins emerge as an increasingly diverse family of chromatin regulators.[Keywords: HP1; WOC; ROW/CG8092; chromatin; Drosophila] Supplemental material is available at http://www.genesdev.org.

show abstract

HP1 modulates the transcription of cell-cycle regulators in Drosophila melanogaster

Cited by 79 publications

References 53 publications

Drosophila STAT is required for directly maintaining HP1 localization and heterochromatin stability

Drosophila STAT is required for directly maintaining HP1 localization and heterochromatin stability

Drosophila PIWI associates with chromatin and interacts directly with HP1a

Drosophila HP1c isoform interacts with the zinc-finger proteins WOC and Relative-of-WOC to regulate gene expression

Contact Info

Product

Resources

About