HOX13-MEDIATEDDBX2REGULATION IN LIMBS SUGGESTS INTER-TAD SHARING OF ENHANCERS

Abstract

BackgroundDuring tetrapod limb development, the HOXA13 and HOXD13 transcription factors are critical for the emergence and organization of the autopod, the most distal aspect where digits will develop. Since previous work had suggested that the Dbx2 gene is a target of these factors, we set up to analyze in detail this potential regulatory interaction.ResultsWe show that HOX13 proteins bind to eutherian-specific sequences at the vicinity of the Dbx2 locus that have enhancer activity in developing digits. However, the functional inactivation of the DBX2 protein did not elicit any particular phenotype related to Hox genes inactivation in digits, suggesting either redundant or compensatory mechanisms. We report that the neighboring Nell2 and Ano6 genes are also expressed in distal limb buds and are, in part, controlled by the same Dbx2 enhancers despite being localized into two different topologically associating domains (TADs) flanking the Dbx2 locus.ConclusionsWe conclude that Hoxa13 and Hoxd genes cooperatively activate Dbx2 expression in developing digits through binding to eutherian specific regulators elements in the Dbx2 neighborhood. Furthermore, these enhancers can overcome TAD boundaries in either direction to co-regulate a set of genes located in distinct chromatin domains.Bullet pointsHoxa13 and Hoxd genes cooperatively regulate Dbx2 expression in developing digits via eutherian specific enhancers.Dbx2 is expressed in different digit joint precursors but its function there is not essential.Dbx2 enhancers also control the expression of the Nell2 and Ano6 genes, which are located in different TADs, thus overcoming the boundary effect.Dbx2 chromatin architecture and enhancers evolved in the mammalian lineage.Grant Sponsor and NumberSwiss National Research Foundation #310030B_138662.European Research Council grants RegulHox #588029

Detecting chromosomal interactions in Capture Hi-C data with CHiCAGO and companion tools

“…As expected, the detected interactions are strongly enriched within the same TAD 23,29,48 . However, multiple cross-TAD contacts are still observed in CHi-C data 23,29,48 , and a recent study 52 has provided evidence that such contacts may play a functional role in developmental gene control.…”

A novel chromosome 2q24.3‐q32.1 microdeletion in a fetus with multiple malformations

“…Deletion, translocation, or disruption of this locus can reportedly cause camptodactyly, syndactyly, brachydactyly, ectrodactyly, and polydactyly 14,19 . Considering the current case study, the deletion contained HOXD13 , an essential gene for regulating and developing the genital tract and autopod that forms hands and feet 20 . In addition, it has been suggested that the HOXD cluster can regulate the size and number of digits in a dose‐dependent manner, indicating a negative relationship between the HOXD gene and digit number rather than qualitative functions 21,22 .…”

“… 14 , 19 Considering the current case study, the deletion contained HOXD13 , an essential gene for regulating and developing the genital tract and autopod that forms hands and feet. 20 In addition, it has been suggested that the HOXD cluster can regulate the size and number of digits in a dose‐dependent manner, indicating a negative relationship between the HOXD gene and digit number rather than qualitative functions. 21 , 22 In the presence of multiple homozygous HOXD mutations, major limb defects are likely to occur.…”

Context-dependent enhancer function revealed by targeted inter-TAD relocation

“…CUT and RUN libraries were sequenced paired-end on a HiSeq4000 sequencer and processed as in 26 , mapped either on mm10 or on the II1TDOM-542 mutant genome. The E11.5 whole-forelimb HOXA13 and HOXD13 ChIP-Seq datasets (SRR3498934 of GSM2151013 and SRR3498935 of GSM2151014) as well as E12.5 distal and proximal forelimb H3K27Ac and CTCF ChIP-Seq datasets (SRR5855214 of GSM2713703, SRR5855215 of GSM2713704, SRR5855220 of GSM2713707, and SRR5855221 of GSM2713708) were processed similarly to what has been previously published 56 . Adapter sequences and bad quality bases were removed with Cutadapt 57 version 1.16 with options -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -q 30 -m 15 (−A being used only in PE data sets).…”