Host use and seasonality of Culex (Melanoconion) iolambdis (Diptera: Culicidae) from eastern Florida, USA

Blosser, Erik M.; Stenn, Tanise; Acevedo, Carolina; Burkett‐Cadena, Nathan D.

doi:10.1016/j.actatropica.2016.10.001

Cited by 22 publications

(28 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Regions of extracted DNA were amplified with PCR using three primer sets (Blosser et al, ) targeting different vertebrate taxa. All samples were run initially on the mammalian/amphibian primer set (F: CTCCATAGGGTCTTCTCGTCTT, R: GCCTGTTTACCAAAAACATCAC).…”

Section: Methodsmentioning

confidence: 99%

Host use patterns of Culicoides spp. biting midges at a big game preserve in Florida, U.S.A., and implications for the transmission of orbiviruses

McGregor

Stenn

Sayler

et al. 2018

Medical Vet Entomology

View full text Add to dashboard Cite

Culicoides spp. biting midges (Diptera: Ceratopogonidae) are vectors of pathogens that have a significant economic impact on the livestock industry. White-tailed deer (Odocoileus virginianus), a farmed species in the U.S.A., are susceptible to two Culicoides spp. borne orbiviruses: bluetongue virus and epizootic haemorrhagic disease virus. Elucidating host-vector interactions is an integral step in studying disease transmission. This study investigated the host range of Culicoides spp. present on a big game preserve in Florida on which a variety of Cervidae and Bovidae freely roam. Culicoides were captured with Centers for Disease Control and Prevention (CDC) miniature light traps run twice weekly on the preserve for 18 consecutive months (July 2015-December 2016). Host preference was quantified through forage ratios, based upon PCR-based bloodmeal analysis of Culicoides spp. and overall animal relative abundance on the preserve. Culicoides stellifer preferentially fed on Cervus spp. and fallow deer (Dama dama) and displayed a relative avoidance of Bovidae and white-tailed deer. Culicoides debilipalpis preferred white-tailed deer and avoided all Bovidae. Culicoides pallidicornis and Culicoides biguttatus showed preferences for white-tailed deer and Père David's deer (Elaphurus davidianus), respectively. These results add to current knowledge of preferred hosts of Florida Culicoides spp. and have implications for the spread of orbiviruses. Copyright © 2018 John Wiley & Sons, Ltd.

show abstract

Section: Methodsmentioning

confidence: 99%

Host use patterns of Culicoides spp. biting midges at a big game preserve in Florida, U.S.A., and implications for the transmission of orbiviruses

McGregor

Stenn

Sayler

et al. 2018

Medical Vet Entomology

View full text Add to dashboard Cite

show abstract

“…bivittatus , an introduced host. Native mosquito species have been documented feeding from other exotic reptile species in Florida [ 36 ], but interactions between P . bivittatus and mosquitoes are not known in the state.…”

Section: Introductionmentioning

confidence: 99%

Interactions between the invasive Burmese python, Python bivittatus Kuhl, and the local mosquito community in Florida, USA

et al. 2018

View full text Add to dashboard Cite

The Burmese python, Python bivittatus Kuhl, is a well-established invasive species in the greater Everglades ecosystem of southern Florida, USA. Most research on its ecological impacts focuses on its role as a predator and its trophic interactions with native vertebrate species, particularly mammals. Beyond predation, there is little known about the ecological interactions between P. bivittatus and native faunal communities. It is likely that established populations of P. bivittatus in southern Florida serve as hosts for native mosquito communities. To test this concept, we used mitochondrial cytochrome c oxidase subunit I DNA barcoding to determine the hosts of blood fed mosquitoes collected at a research facility in northern Florida where captive P. bivittatus and Argentine black and white tegu, Salvator merianae (Duméril and Bibron), are maintained in outdoor enclosures, accessible to local mosquitoes. We recovered python DNA from the blood meals of three species of Culex mosquitoes: Culex erraticus (Dyar and Knab), Culex quinquefasciatus Say, and Culex pilosus (Dyar and Knab). Culex erraticus conclusively (P = 0.001; Fisher’s Exact Test) took more blood meals from P. bivittatus than from any other available host. While the majority of mosquito blood meals in our sample were derived from P. bivittatus, only one was derived from S. merianae. These results demonstrate that local mosquitoes will feed on invasive P. bivittatus, a recently introduced host. If these interactions also occur in southern Florida, P. bivittatus may be involved in the transmission networks of mosquito-vectored pathogens. Our results also illustrate the potential of detecting the presence of P. bivittatus in the field through screening mosquito blood meals for their DNA.

show abstract

“…2 c), Culex erraticus , or Culex cedecei . Both Culex iolambdis and Culex erraticus are relative host generalists that take blood meals from all terrestrial vertebrate classes 25 , 28 . Culex cedecei , the primary vector of Everglades virus (a strain, Subtype II, of the Venezuelan equine encephalitis virus 29 ), is a relative specialist of mammalian hosts, but primarily takes blood meals from rodents in the Everglades 21 .…”

Section: Resultsmentioning

confidence: 99%

Interactions between the imperiled West Indian manatee, Trichechus manatus, and mosquitoes (Diptera: Culicidae) in Everglades National Park, Florida, USA

Reeves

Gillett-Kaufman

2020

Sci Rep

View full text Add to dashboard Cite

Arthropod-borne viruses (arboviruses), including those vectored by mosquitoes, have recently been cited as potential emerging health threats to marine mammals. Despite the fully aquatic habits of cetaceans, immunologic exposure to arboviruses including West nile virus and eastern equine encephalitis virus has been detected in wild Atlantic bottlenose dolphins, and captive orcas have been killed by West nile virus and St. Louis encephalitis virus. currently, there is no evidence of direct interactions between mosquitoes and marine mammals in nature, and it remains unknown how wild cetaceans are exposed to mosquito-vectored pathogens. Here, we report the first evidence of direct interactions between an aquatic mammal, the West indian manatee, a federally threatened species, and mosquitoes in nature. observations of manatees in everglades national park, florida, USA, indicate that mosquitoes of three genera, Aedes, Anopheles, and Culex are able to locate and land on surface-active manatees, and at minimum, penetrate and probe manatee epidermis with their mouthparts. Whether mosquitoes can successfully take a blood meal is not known; however, an arbovirus-infected mosquito can inoculate extravascular host tissues with virus-infected saliva during probing. these observations suggest that it is possible for marine mammals to be exposed to mosquito-vectored pathogens through direct interactions with mosquitoes. The importance of mosquitoes to domesticated animal and human health, as the vectors of disease-causing pathogens, is widely recognized. Less well understood is the importance of mosquitoes in ecosystems and their impact on wildlife health 1. Female mosquitoes of most species require a blood meal, taken from another animal, in order to obtain proteins necessary to complete egg development 2. This requirement can facilitate the transmission of diverse pathogens, particularly viruses, protozoa, and helminths, between vertebrate hosts. The host-use patterns of mosquitoes vary by species. Mosquitoes take blood from all major terrestrial vertebrate classes: Amphibia, Aves, Mammalia, and Reptilia, and at least one is an invertebrate specialist of Annelida hosts 3. Most mosquitoes specialize on particular types (e.g., endo-or ectothermic animals) or classes of host animals, with a few mosquito species that are relative generalists. Mosquitoes are well known to take blood from host animals that are amphibious or primarily aquatic. Some mosquito species are host specialists of frogs, including ranids that are closely associated with aquatic habitats 4-6 , and fishes, e.g., mudskippers, other gobies, and eels 7,8. Crocodilians 9,10 , and semi-aquatic snakes and turtles (e.g., Agkistrodon piscivorus, Python bivittatus, and Trachemys scripta) often serve as hosts for opportunistic mosquitoes 11-13. There is no direct evidence of interactions between mosquitoes and marine mammals in nature, however, mosquito-vectored viruses (e.g., West Nile virus, Eastern equine encephalitis virus, St. Louis encephalitis virus, and Venezuela...

show abstract

Host use and seasonality of Culex (Melanoconion) iolambdis (Diptera: Culicidae) from eastern Florida, USA

Cited by 22 publications

References 24 publications

Host use patterns of Culicoides spp. biting midges at a big game preserve in Florida, U.S.A., and implications for the transmission of orbiviruses

Host use patterns of Culicoides spp. biting midges at a big game preserve in Florida, U.S.A., and implications for the transmission of orbiviruses

Interactions between the invasive Burmese python, Python bivittatus Kuhl, and the local mosquito community in Florida, USA

Interactions between the imperiled West Indian manatee, Trichechus manatus, and mosquitoes (Diptera: Culicidae) in Everglades National Park, Florida, USA

Contact Info

Product

Resources

About