Host-associated differences in morphometric traits of parasitic larvae Hirsutiella zachvatkini (Actinotrichida: Trombiculidae)

Abstract

Examination of host-associated variation in the chigger mite Hirsutiella zachvatkini (Schluger) revealed morphological differences among larvae infesting sympatric hosts: Apodemus agrarius, Apodemus flavicollis and Myodes glareolus. The analysis included 61 variables of larvae obtained from their gnathosoma, idiosoma and legs (measurements and counts). Statistically significant differences were observed for metric characters of the legs as opposed to the scutum. In view of the conspecificity of the mites, supported by comparison of COI gene products obtained from larvae and laboratory-reared deutonymphs, the observed variation is attributed to phenotypic plasticity. The knowledge of larval morphology, including intraspecific variation of metric characters, supported by molecular and host range data, places H. zachvatkini among the most comprehensively defined members of Trombiculidae.

Molecular detection of Rickettsia genus in chigger mites (Trombidiformes: Trombiculidae) collected on small mammals in southeastern brazilian

“…The mitochondrial COI gene has a faster rate of sequence divergence if compared with nuclear ribosomal genes (OTTO & WILSON, 2001). Kampen et al (2004), Moniuszko et al (2015) and Kumlert et al (2018) successfully amplified this gene for some chigger species of the genera Ascoschoengastia, Blankaartia, Hirsutella, Leptotrombidium, Neotrombicula, Schoengastia, Schoutedenichia, and Walchia, from Europe and Asia. Although in the current study we employed this same pairs of primers, none of our samples yielded amplicons, which is in the line with previous studies in Brazil (BASSINI-SILVA et al, 2018a;JACINAVICIUS et al, 2018a).…”

Inter- and intraspecific variability of morphological and molecular characters in Allothrombium species, with special reference to Allothrombium fuliginosum

“…Altogether, 25 sequences were obtained, including 18 of COI and seven of ITS2 (including one partial sequence, forward strain only). For DNA extraction and isolation protocol see Moniuszko et al (2015). Amplification of the COI barcode region was performed using degenerate primers: bcdF04 (5′-CAT TTT CHACT AAY CAT AAR GAT ATT GG-3′) and bcdR04 (5′-TAT AAA CYTCDGGATGNCCA AAA AA-3′) (Dabert et al 2010) in the following thermocycling conditions: 95 °C for 3 min-initial denaturation; 95 °C for 20 s, 46 °C for 20 s, 72 °C for 45 s-40 cycles; 72 °C for 7 min-final extending.…”

>b<Chigger mites (Trombidiformes: Trombiculidae) of small mammals from Brazil:>/b< morphological studies and investigation of the presence of pathogens

“…These sequences correspond to the first molecular identification of the genus Quadraseta. Kampen (2004) succeeded in amplifying the COI gene of Neotrombicula autumnalis (Shaw, 1790) larvae using primers for Tetranychidae mites designed by Navajas (1994); moreover, Moniuszko et al (2015) were successful in amplifying the same gene, from larvae and deutonymphs of Hirsutiella zachvatkini (Schluger, 1948), using the primers by . In the present study, both pairs of primers were tested and none of them amplified the COI gene for Q. brasilensis.…”

“…(CATTTTCHACTAAYCATAARGATATTGG) and bcdR04 (TATAAACYTCDGGATGNCCAAAAAA) as described by ) with adaptations of Moniuszko et al (2015); and 772 (TGATTTTTTGGTCACCCAGAAG) and 773 (TACAGCTCCTATAGATAAAAC) as described by Navajas (1994). For each reaction, negative (Milli-Q water free of DNA) and positive controls (chigger mite pools) were used.…”

“…The mitochondrial COI gene is known by the faster rate of sequence divergence than nuclear ribosomal genes (OTTO and WILSON, 1998). Kampen (2004), Moniuszko et al (2015) and Kumlert et al (2018) succeeded in amplifying this gene for some species of the chigger genera Ascoschoengastia, Blankaartia, Hirsutiella, Leptotrombidium, Neotrombicula, Schoengastia, Schoutedenichia, and Walchia, from Europe and Asia. However, in the present study, we tested the pairs of primers used by those authors and none of them amplified in our samples, similarly to previous studies in Brazil ).…”