Host anti-microbial response to Helicobacter pylori infection

George, J. T.; Boughan, Parjeet K.; Karageorgiou, Haris; Bajaj-Elliott, Mona

doi:10.1016/s0161-5890(03)00158-5

Cited by 45 publications

(42 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Conditions for ␤-defensin RT-PCR have been described previously (38,39). NOD1 primers utilized were: sense, ATTCTGGACCTGGTACAGAGC; anti-sense, CAGGATGAAGA-TGGTCTCACC.…”

Section: Methodsmentioning

confidence: 99%

“…We and others (36 -40) have previously shown both in vitro and in vivo increased mRNA and peptide expression of gastric ␤-defensins during H. pylori infection. Importantly, we found hBD2 and -3 to be potent bactericidal agents against H. pylori (39,40). The increased expression and high microbicidal activity of hBDs against the bacterium led us to hypothesize that dynamic modulation of host epithelial antimicrobial responses by bacterial virulence factors may be a critical determinant of bacterial adherence and subsequent pathology in a susceptible individual.…”

mentioning

confidence: 89%

See 1 more Smart Citation

Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor

Boughan¹,

Argent

Body-Malapel

et al. 2006

Journal of Biological Chemistry

Self Cite

159

View full text Add to dashboard Cite

Host-pathogen interactions that allow Helicobacter pylori to survive and persist in the stomach of susceptible individuals remain unclear. Human ␤-defensins (hBDs), epithelial-derived antimicrobial peptides are critical components of host-defense at mucosal surfaces. The role of H. pylori-mediated NF-B and epidermal growth factor receptor (EGFR) activation on ␤-defensin expression was investigated. Transient transfection studies utilizing ␤-defensin promoter constructs were conducted in gastric cells with contribution of individual signaling events evaluated by the addition of specific inhibitors, small interference nucleotide-binding oligomerization domain 1 (NOD1) RNA or plasmids encoding Vaccinia virus proteins that interrupt interleukin-1 and Toll-like receptor signaling. The role of individual MAPK pathways was further delineated in HEK-293 cells expressing conditional MAPK mutants. We found hBD2 expression exclusively dependent on the presence of the bacterial cag pathogenicity island, with NOD1 a critical host sensor. Impairment of murine ␤-defensin 4 (an orthologue of hBD2) expression in NOD1-deficient mice 7-days post-infection further confirmed the role of this cytoplasmic pattern-recognition receptor in eliciting host innate immunity. In contrast to hBD2, hBD3 expression was NOD1-independent but EGFR and ERK pathway-dependent. Importantly, Toll-like receptor signaling was not implicated in H. pylori-mediated hBD2 and hBD3 gene expression. The divergent signaling events governing hBD2 and hBD3 expression suggest temporal functional variation, such that hBD2 may contribute to antimicrobial barrier function during the inflammatory phase with hBD3 playing a greater role during the repair, wound healing phase of infection.

show abstract

“…Conditions for ␤-defensin RT-PCR have been described previously (38,39). NOD1 primers utilized were: sense, ATTCTGGACCTGGTACAGAGC; anti-sense, CAGGATGAAGA-TGGTCTCACC.…”

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 89%

Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor

Boughan¹,

Argent

Body-Malapel

et al. 2006

Journal of Biological Chemistry

Self Cite

159

View full text Add to dashboard Cite

show abstract

“…A total of 5 l (1 l for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) of cDNA was routinely amplified with 20 pmol of each oligonucleotide primer (Sigma-Aldrich), 1.5 mM MgCl 2 , 200 M deoxynucleoside triphosphates, and 0.5 U of Taq polymerase. Primer sequences were as described previously (3,12). After a 3-min hot start at 94°C, the amplification profile used was denaturation at 94°C for 90 s, annealing at 60°C for 90 s, and extension at 72°C for 90 s. PCRs were allowed to continue for 34 to 37 cycles, ensuring termination in the linear phase of the reaction.…”

Section: Methodsmentioning

confidence: 99%

Intestinal Innate Immunity toCampylobacter jejuniResults in Induction of Bactericidal Human Beta-Defensins 2 and 3

et al. 2005

Self Cite

View full text Add to dashboard Cite

Campylobacter jejuni is the most prevalent cause of bacterial diarrhea worldwide. Despite the serious health problems caused by this bacterium, human innate immune responses to C. jejuni infection remain poorly defined. Human ␤-defensins, a family of epithelial antimicrobial peptides, are a major component of host innate defense at the gastrointestinal mucosal surface. In this study, the effect of two different C. jejuni wild-type strains on human intestinal epithelial innate responses was investigated. Up-regulation of ␤-defensin gene and peptide expression during infection was observed and recombinant ␤-defensins were shown to have a direct bactericidal effect against C. jejuni through disruption of cell wall integrity. Further studies using an isogenic capsule-deficient mutant showed that, surprisingly, the absence of the bacterial polysaccharide capsule did not change the innate immune responses induced by C. jejuni or the ability of C. jejuni to survive exposure to recombinant ␤-defensins. This study suggests a major role for this family of antimicrobial peptides in the innate immune defense against this human pathogen.

show abstract

“…The myeloid ELF-1-like factor (MEF) is involved in innate immunity responses, such as the activation of perforin and lysozyme transcription (368, 370), and also increased the level of endogenous hBD-2 transcription (229, 369). In addition, it is interesting that elevated levels of hBD-2 and hBD-3 transcripts have been found in Helicobacter pylori-infected gastric cells (20,122,143,400,401,408). Enteric pathogens have developed sophisticated strategies to survive in the gastrointestinal tract by evading the host defenses.…”

Section: Antimicrobial Activitiesmentioning

confidence: 99%

The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota

2006

View full text Add to dashboard Cite

SUMMARY The intestinal tract is a complex ecosystem that combines resident microbiota and the cells of various phenotypes with complex metabolic activities that line the epithelial wall. The intestinal cells that make up the epithelium provide physical and chemical barriers that protect the host against the unwanted intrusion of microorganisms that hijack the cellular molecules and signaling pathways of the host and become pathogenic. Some of the organisms making up the intestinal microbiota also have microbicidal effects that contribute to the barrier against enteric pathogens. This review describes the two cell lineages present in the intestinal epithelium: the goblet cells and the Paneth cells, both of which play a pivotal role in the first line of enteric defense by producing mucus and antimicrobial peptides, respectively. We also analyze recent insights into the intestinal microbiota and the mechanisms by which some resident species act as a barrier to enteric pathogens. Moreover, this review examines whether the cells producing mucins or antimicrobial peptides and the resident microbiota act in partnership and whether they function individually and/or synergistically to provide the host with an effective front line of defense against harmful enteric pathogens.

show abstract

Host anti-microbial response to Helicobacter pylori infection

Cited by 45 publications

References 28 publications

Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor

Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor

Intestinal Innate Immunity toCampylobacter jejuniResults in Induction of Bactericidal Human Beta-Defensins 2 and 3

The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota

Contact Info

Product

Resources

About