Homologous recombination between different genotypes of hepatitis B virus

Morozov, Viacheslav; Pisareva, Maria; Groudinin, Mikhail

doi:10.1016/s0378-1119(00)00424-8

Cited by 88 publications

(96 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Similarly, Hino et al (1991) showed that this same HBV DNA region covering nt 1855-1915, comprising DR1, was indispensable for enhancement of a recombination assay (Hino et al, 1991). After analysing 99 complete HBV sequences, Morozov et al (2000) described homologous recombination between different genotypes and confirmed similar regularity in the distribution of recombinant sites in the vicinity of DR1 and at the 39 end of the core gene.…”

Section: Discussionmentioning

confidence: 83%

A novel hepatitis B virus (HBV) subgenotype D (D8) strain, resulting from recombination between genotypes D and E, is circulating in Niger along with HBV/E strains

Chekaraou

Brichler

Mansour

et al. 2010

Journal of General Virology

View full text Add to dashboard Cite

Niger is a west African country that is highly endemic for hepatitis B virus (HBV) infection. The seroprevalence for HBV surface antigen (HBsAg) is about 20 %; however, there are no reports on the molecular epidemiology of HBV strains spreading in Niger. In the present study, HBV isolates from the sera of 58 consecutive, asymptomatic, HBsAg-positive blood donors were characterized. Genotype affiliation was determined by amplification, sequencing and phylogenetic analysis of the preS1, polymerase/reverse transcriptase (RT/Pol) and precore (preC)/C regions. The first series of results revealed that different genomic fragments clustered with different genotypes on phylogenetic trees, suggesting recombination events. Twenty-four complete genomic sequences were obtained by amplification and sequencing of seven overlapping regions covering the whole genome, and were studied by extensive phylogenetic analysis. Among them, 20 (83.3 %) were classified unequivocally as genotype E (HBV/E). The remaining four (16.7%) clustered on a distinct branch within HBV/D with strong bootstrap and posterior probability values. Complete molecular characterization of these four strains was achieved by the Simplot program, bootscanning analysis and cloning experiments, and enabled us to identify an HBV/D-E recombinant that formed a new HBV/D subgenotype spreading in Niger, tentatively named D8. Moreover, 20 new complete HBV/E nucleotide sequences were determined that exhibited higher genetic variability than is generally described in Africa. One was found to be a recombinant containing HBV/D sequences in the preS2 and RT/Pol regions. Taken together, these data suggest that, in Niger, genetic variability of HBV strains is still evolving, probably reflecting ancient endemic HBV infection. INTRODUCTIONHepatitis B virus (HBV) infection remains a major public health problem, particularly in Africa, although data for precisely estimating the burden of HBV infection are lacking. It is estimated that 2 billion people worldwide are or have been infected with HBV (WHO: http://www.who. int/csr/disease/hepatitis/HepatitisB_whocdscsrlyo2002_2.pdf), among whom over 360 million are in a chronic carrier state with a high risk of developing cirrhosis and hepatocellular carcinoma (Ganem & Prince, 2004;Lee et al., 1997;Lok, 2004). About 70-140 million of these carriers live in Africa, and about 250 000 of the 1.3 million HBV-related deaths recorded each year throughout the world occur in Africa (Andernach et al., 2009;Hubschen et al., 2008;Kramvis & Kew, 2007;Kramvis et al., 2002;Mulders et al., 2004). HBV belongs to the family Hepadnaviridae and is characterized by a partially double-stranded circular DNA genome of 3These authors contributed equally to this work.The GenBank/EMBL/DDBJ accession numbers for the sequences determined in this study are FN594748-FN594771.A supplementary list of additional GenBank sequences used in this study is available with the online version of this paper. RESULTS Nucleotide sequences and phylogenetic analysesSeveral nucleot...

show abstract

Section: Discussionmentioning

confidence: 83%

A novel hepatitis B virus (HBV) subgenotype D (D8) strain, resulting from recombination between genotypes D and E, is circulating in Niger along with HBV/E strains

Chekaraou

Brichler

Mansour

et al. 2010

Journal of General Virology

View full text Add to dashboard Cite

show abstract

“…Furthermore, in many cases described in that report, favored positions for both inter-and intragenotype recombination matched the positions of phylogenetic reorganization between human and ape genotypes, such as the end of the surface gene and the core gene, where sequence relationships between genotypes changed in the TreeOrder scan. To date, intergenotype recombination with genotype B/C (15,25) was surprising, because the circulating HBV genotypes in Vietnam are B, C, and rarely A (27,28). More interestingly, genotype G is quite rare in Asia and undetectable in Vietnam (6,28).…”

Section: Hepatitis B Virus (Hbv) Infection Is a Global Health Problemmentioning

confidence: 99%

New Complex Recombinant Genotype of Hepatitis B Virus Identified in Vietnam

Huy

Ngoc

Abe

2008

J Virol

222

116

View full text Add to dashboard Cite

Hepatitis B virus (HBV) infection is a global health problem.Approximately 350 million people worldwide are chronic carriers of the virus (12). Eight HBV genotypes from A to H are defined by a divergence in the entire nucleotide sequence of more than 8% (1,14,18,19,23). The prevalence and distribution of HBV genotypes vary geographically (6,8,9). Some genotypes have been split into subgroups. In particular, Asian strains of HBV (genotypes B and C) vary genetically and can be classified into various subgroups (21). In addition to these classifications, intergenotypic recombinant of HBV has been observed in geographical regions where there are cocirculating genotypes (2,3,5,11,20,25,26). We report here the complete genomic sequence and phylogenetic analyses of an HBV strain isolated in Vietnam that has shown a high divergence from these genotypes and also a novel complex recombinant.A serum sample was obtained from a 31-year-old male Vietnamese patient who lived in Hanoi, Vietnam. He was diagnosed with acute hepatitis B at Bach Mai Hospital, Hanoi, Vietnam, in 2003. This patient was seropositive for HBsAg and immunoglobulin M anti-HBc antibody with a high level of alanine transaminase (1,990 UI/liter). PCR using HBV genotype-specific primers (16) was used to amplify the virus genotype. The full-length 3.2 kb was amplified by using single-round amplification of the full HBV genome, using the primer pair HBV4 5Ј-CCGGAAAGCTTATGCTCTTCTTTTTCACCTC TGCCTAATCATC-3Ј (sense; underlining of the primer sequence indicates the HindIII site) and HBV4R 5Ј-CCGGAG AGCTCATGCTCTTCAAAAAGTTGCATGGTGCTGGT G-3Ј (antisense; underlining of the primer sequence indicates the SacI site) (4). PCR and sequencing analyses were done as described previously (17). Briefly, viral DNA was extracted from 100 l of serum by using a DNA/RNA extraction kit (SepaGene RV-R; Sanko Junyaku Co., Ltd., Tokyo, Japan).The resulting pellet was resuspended in 50 l of RNase-free water and kept at Ϫ20°C until use. The PCR conditions consisted of preincubation at 94°C and a 2-min activation of Blend Taq-Plus DNA polymerase (Toyobo, Ltd., Tokyo, Japan), followed by 40 cycles of PCR (94°C for 15 s, 55°C for 45 s, and 72°C for 3 min 20 s), with a final extension for 7 min at 72°C. The PCR products were separated by 1% agarose gel electrophoresis and purified by using a QIAquick gel extraction kit (Qiagen, Inc., Chatsworth, CA). Purified DNA was subjected to direct sequencing using an ABI Prism BigDye terminator cycle sequencing ready reaction kit and automated an ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA). Evolutionary and phylogenetic tree analysis were performed by using MEGA software version 3.0 (10), using the neighborjoining method, with 1,000 bootstrapped data sets. Genetic distance calculation and pairwise distance comparisons used the Kimura two-parameter model integrated into the MEGA software. Intergenotype recombination of HBV strains was investigated by using the SIMPLOT program version 3.5 (http: //sray.med.som.jhmi.edu/SCRoftware/simplot/ [...

show abstract

“…Recombination has been reported to occur in HBV when genomes of different genotypes co-exist in the same host and is a way of introducing variability (Bollyky et al, 1996;Morozov et al, 2000). In some regions, recombinant forms are taking over and are distributed more widely than the parental genotypes, as reported with the B/C recombinant in Asia .…”

Section: Introductionmentioning

confidence: 99%

Deletions and recombinations in the core region of hepatitis B virus genotype E strains from asymptomatic blood donors in Guinea, west Africa

Garmiri

Loua²,

Haba³

et al. 2009

Journal of General Virology

View full text Add to dashboard Cite

The prevalence of hepatitis B virus (HBV) surface antigen (HBsAg) chronic carriage in west Africa is the highest in the world, but its molecular epidemiology remains relatively poorly investigated. Plasma samples from random asymptomatic carriers of HBsAg in Conakry, Guinea, were studied and the complete genome sequences of 81 strains were obtained. Three additional samples from Kumasi, Ghana, were also included in the analysis. Phylogenetic analyses confirmed the dominance of genotype E (95.1 %), including 8.6 % of strains (viral load, 5¾10 3 -2.6¾10 8 IU ml "1 ) comprising dominant variants with large deletions in the core region and minority wild-type variants. The presence of two different patterns of deletions in two and four donors suggested targeted genome fragility between nt 1979 and 2314. The remaining sequences included one subgenotype A3 (1 %) and six A/E recombinant forms (4-7 %). A/E strains with identical points of recombination in three donors suggested strongly that these recombinant HBV strains are circulating and transmitted in the population. Recombination points were concentrated in the core gene. The detection of similar A/E recombinant strains in Ghana suggested a geographical extension of recombinant HBV to the region. The quasispecies of one additional Ghanaian strain sequenced in the pre-surface/surface region resolved into dominant clones of either the A or E genotype, but also three different patterns of A/E recombinant variants. The observation that both deletions of genotype E strains and A/E recombination points are mostly located in the core gene at specific positions indicates a region of the genome where genetic rearrangements preferentially take place.

show abstract

Homologous recombination between different genotypes of hepatitis B virus

Cited by 88 publications

References 26 publications

A novel hepatitis B virus (HBV) subgenotype D (D8) strain, resulting from recombination between genotypes D and E, is circulating in Niger along with HBV/E strains

A novel hepatitis B virus (HBV) subgenotype D (D8) strain, resulting from recombination between genotypes D and E, is circulating in Niger along with HBV/E strains

New Complex Recombinant Genotype of Hepatitis B Virus Identified in Vietnam

Deletions and recombinations in the core region of hepatitis B virus genotype E strains from asymptomatic blood donors in Guinea, west Africa

Contact Info

Product

Resources

About