Homogeneous Preparations of 3′-Phosphoglycolate-Terminated Oligodeoxynucleotides from Bleomycin-Treated DNA as Verified by Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry

Chen, Shuang; Hannis, James C.; Flora, Jason W.; Muddiman, David C.; Charles, Kwabena; Yin, Yanqing; Povirk, Lawrence F.

doi:10.1006/abio.2000.4936

Cited by 18 publications

(24 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1). The structure of the 3Ј-PG oligomers was verified by Fourier transform electrospray ionization mass spectrometry; all species detected could be ascribed to isotopes or salts of the oligomer or to the internal standard, with no detectable contaminants (24).…”

Section: Methodsmentioning

confidence: 99%

Accurate in Vitro End Joining of a DNA Double Strand Break with Partially Cohesive 3′-Overhangs and 3′-Phosphoglycolate Termini

Chen

Inamdar

Pfeiffer

et al. 2001

Journal of Biological Chemistry

Self Cite

108

113

View full text Add to dashboard Cite

To examine determinants of fidelity in DNA end joining, a substrate containing a model of a staggered free radical-mediated double-strand break, with cohesive phosphoglycolate-terminated 3-overhangs and a onebase gap in each strand, was constructed. In extracts of Xenopus eggs, human lymphoblastoid cells, hamster CHO-K1 cells, and a Chinese hamster ovary (CHO) derivative lacking the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), the predominant end joining product was that corresponding to accurate restoration of the original sequence. In extracts of the Ku-deficient CHO derivative xrs6, a shorter product, consistent with 3 3 5 resection before ligation, was formed. Similar results were seen for a substrate with 5-overhangs and recessed 3-phosphoglycolate ends. Supplementation of the xrs6 extracts with purified Ku restored accurate end joining. In Xenopus and human extracts, but not in hamster extracts, gap filling and ligation were blocked by wortmannin, consistent with a requirement for DNA-PKcs activity. The results suggest a Ku-dependent pathway, regulated by DNA-PKcs, that can accurately restore the original DNA sequence at sites of free radical-mediated double-strand breaks, by protecting DNA termini from degradation and maintaining the alignment of short partial complementarities during gap filling and ligation.

show abstract

Section: Methodsmentioning

confidence: 99%

Accurate in Vitro End Joining of a DNA Double Strand Break with Partially Cohesive 3′-Overhangs and 3′-Phosphoglycolate Termini

Chen

Inamdar

Pfeiffer

et al. 2001

Journal of Biological Chemistry

Self Cite

108

113

View full text Add to dashboard Cite

show abstract

“…An analogous oligomer (n ϭ 1) bearing a 3Ј-phosphotyrosyl terminus was purchased from Midland Certified Reagents. The 9-and 11-base 3Ј-PG oligomers CGAGG-AACG and CGAGGAACGCG were similarly prepared as described previously and their structures verified by mass spectrometry (12). The 36-base 3Ј-PG or 3Ј-hydroxyl oligomers were prepared by ligating the corresponding labeled 14-mers to the 22-mer GCCATGTACTTGGATGATCTAT in the presence of the complementary 20-mer GCGTTCCTCGATAGA-TCATC and were again gel/HPLC-purified.…”

mentioning

confidence: 99%

“…The yield of each oligomer was determined by integrating the absorbance at 260 nm recorded on an in-line UV monitor. To generate 3Ј-PG oligomers with the sequence CGAGG-AACGCG(A n )CG (0 Յ n Յ 4), 5Ј-32 P-end-labeled oligomers CGAGGAACGCG(A n )CGCCC were treated with bleomycin plus H 2 O 2 , and the desired 14 -17-base 3Ј-PG products were isolated from a sequencing gel and purified by HPLC (12). The terminal structure and purity of the 14-base (n ϭ 1) 3Ј-PG oligomer was verified by electrospray mass spectrometry and fragmentation-based chemical sequencing.…”

mentioning

confidence: 99%

Processing of 3′-Phosphoglycolate-terminated DNA Double Strand Breaks by Artemis Nuclease

Povirk

Zhou

et al. 2007

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

The Artemis nuclease is required for V(D)J recombination and for repair of an as yet undefined subset of radiation-induced DNA double strand breaks. To assess the possibility that Artemis acts on oxidatively modified double strand break termini, its activity toward model DNA substrates, bearing either 3-hydroxyl or 3-phosphoglycolate moieties, was examined. A 3-phosphoglycolate had little effect on Artemis-mediated trimming of long 3 overhangs (>9 nucleotides), which were efficiently trimmed to 4 -5 nucleotides. However, 3-phosphoglycolates on overhangs of 4 -5 bases promoted Artemis-mediated removal of a single 3-terminal nucleotide, while at least 2 nucleotides were trimmed from identical hydroxyl-terminated substrates. Artemis also efficiently removed a single nucleotide from a phosphoglycolate-terminated 3-base 3 overhang, while leaving an analogous hydroxyl-terminated overhang largely intact. Such removal was completely dependent on DNA-dependent protein kinase and ATP and was largely dependent on Ku, which markedly stimulated Artemis activity toward all 3 overhangs. Together, these data suggest that efficient Artemismediated cleavage of 3 overhangs requires a minimum of 2 nucleotides, or a nucleotide plus a phosphoglycolate, 3 to the cleavage site, as well as 2 unpaired nucleotides 5 to the cleavage site. Shorter 3-phosphoglycolate-terminated overhangs and blunt ends were also processed by Artemis but much more slowly. Consistent with a role for Artemis in repair of terminally blocked double strand breaks in vivo, human cells lacking Artemis exhibited hypersensitivity to x-rays, bleomycin, and neocarzinostatin, which all induce 3-phosphoglycolate-terminated double strand breaks.The Artemis genetic locus was identified by virtue of its association with a form of BϪ TϪ NKϩ severe combined immune deficiency (SCID) 2 in humans, designated RS-SCID (radiationsensitive SCID) (1) or SCIDA (Athabascan SCID) (2). The Artemis protein is a nuclease that is activated by DNA-dependent protein kinase (DNA-PK) and is required for the opening of hairpin ends formed during V(D)J recombination (3), thus accounting for the SCID phenotype associated with Artemis deficiency. SCIDA and RS-SCID fibroblasts are radiation-sensitive but fail to repair only a small fraction of radiation-induced DNA double strand breaks (DSBs) (4 -6). In vitro, activated Artemis removes 5Ј overhangs from DNA ends and shortens 3Ј overhangs (7), raising the possibility that during DSB repair in vivo, Artemis may trim overhangs that otherwise cannot be processed to give ligatable ends.About half of DNA breaks induced by ionizing radiation bear 3Ј-phosphoglycolate (3Ј-PG) termini in various contexts (7) that must be removed in order to allow gap filling by DNA polymerases and and ligation by DNA ligase IV (8). Although tyrosyl-DNA phosphodiesterase (TDP1) is the only identified enzyme capable of processing 3Ј-PGs on 3Ј overhangs (9), TDP1 mutant cells show only marginal radiosensitivity (10), suggesting the existence of an alternative pathway for processi...

show abstract

“…Most of these are highly unstable and break down spontaneously to give rise to breaks with 3´ and 5´-phosphates. The exception to this rule is the 3´-PG terminus which is stable even under harsh conditions [22].…”

Section: Structural Modifications At Dna Endsmentioning

confidence: 99%

End-processing nucleases and phosphodiesterases: An elite supporting cast for the non-homologous end joining pathway of DNA double-strand break repair

Menon

Povirk

2016

DNA Repair

Self Cite

View full text Add to dashboard Cite

Homogeneous Preparations of 3′-Phosphoglycolate-Terminated Oligodeoxynucleotides from Bleomycin-Treated DNA as Verified by Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry

Cited by 18 publications

References 39 publications

Accurate in Vitro End Joining of a DNA Double Strand Break with Partially Cohesive 3′-Overhangs and 3′-Phosphoglycolate Termini

Accurate in Vitro End Joining of a DNA Double Strand Break with Partially Cohesive 3′-Overhangs and 3′-Phosphoglycolate Termini

Processing of 3′-Phosphoglycolate-terminated DNA Double Strand Breaks by Artemis Nuclease

End-processing nucleases and phosphodiesterases: An elite supporting cast for the non-homologous end joining pathway of DNA double-strand break repair

Contact Info

Product

Resources

About