Histamine Regulates Molecular Clock Oscillations in Human Retinal Pigment Epithelial Cells via H1 Receptors

Morioka, Eri; Kanda, Yasunari; Koizumi, Hayato; Miyamoto, Tsubasa; Ikeda, Masayuki

doi:10.3389/fendo.2018.00108

Cited by 15 publications

(14 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The existence of a circadian clock in the RPE was recently discovered 10 . Subsequent work has focused on the mechanisms that regulate the RPE clock 11,29–31 and RPE-clock-directed downstream physiology 30,32 . Here, we study the rhythmic machinery of the RPE in further detail.…”

Section: Discussionmentioning

confidence: 99%

Rev-Erbα and Photoreceptor Outer Segments modulate the Circadian Clock in Retinal Pigment Epithelial Cells

Milićević

Mazzaro

Bruin

et al. 2019

Sci Rep

View full text Add to dashboard Cite

Retinal photoreceptor outer segments (POS) are renewed daily through phagocytosis by the adjacent retinal pigment epithelial (RPE) monolayer. Phagocytosis is mainly driven by the RPE circadian clock but the underlying molecular mechanisms remain elusive. Using ARPE-19 (human RPE cell-line) dispersed and monolayer cell cultures, we investigated the influence of cellular organization on the RPE clock and phagocytosis genes. PCR analysis revealed rhythmic expression of clock and phagocytosis genes in all ARPE-19 cultures. Monolayers had a tendency for higher amplitudes of clock gene oscillations. In all conditions ARNTL , CRY1 , PER1-2 , REV-ERBα , ITGB5 , LAMP1 and PROS1 were rhythmically expressed with REV-ERBα being among the clock genes whose expression showed most robust rhythms in ARPE-19 cells. Using RPE-choroid explant preparations of the mPer2 Luc knock-in mice we found that Rev-Erbα deficiency induced significantly longer periods and earlier phases of PER2-bioluminescence oscillations. Furthermore, early phagocytosis factors β 5 -Integrin and FAK and the lysosomal marker LAMP1 protein levels are rhythmic. Finally, POS incubation affects clock and clock-controlled phagocytosis gene expression in RPE monolayers in a time-dependent manner suggesting that POS can reset the RPE clock. These results shed some light on the complex interplay between POS, the RPE clock and clock-controlled phagocytosis machinery which is modulated by Rev-Erbα .

show abstract

Section: Discussionmentioning

confidence: 99%

Rev-Erbα and Photoreceptor Outer Segments modulate the Circadian Clock in Retinal Pigment Epithelial Cells

Milićević

Mazzaro

Bruin

et al. 2019

Sci Rep

View full text Add to dashboard Cite

show abstract

“…We validated the reporter in RPE-1 cells by showing that it translocated into the cytosol when the cells were treated by histamine (Extended Data Fig. 3c and d), which transiently increased cytosolic Ca 2+ concentration 20 (data not shown). This translocation was enhanced by co-expressed exogenous CaMKII, and blunted by co-expressed kinase-dead CaMKII mutant 21 (CaMKII K43M ) and by the CaMKII-specific inhibitory protein CaMKIIN 22 , supporting that the KTR translocation was driven by CaMKII activity.…”

Section: Residues Confer Ros Sensitivity To Camkii In Vertebrates mentioning

confidence: 94%

CaMKII oxidation is a performance/disease trade-off in vertebrate evolution

Wang¹,

Hernández‐Ochoa

Viswanathan³

et al. 2019

Preprint

View full text Add to dashboard Cite

32 33 34 Reactive oxygen species (ROS) contribute to health and disease. CaMKII is a widely 35 expressed enzyme whose activation by oxidation of regulatory domain methionines (ox-36 CaMKII) contributes to cardiovascular disease, asthma, and cancer. Here we integrate 37 comparative genomic and experimental data to show that CaMKII activation by ROS 38 arose more than half-a-billion years ago on the vertebrate stem lineage where it constituted 39 a bridge between ROS and increased intracellular Ca 2+ release, exercise responsive gene 40 transcription, and improved performance in skeletal muscle. These enhancements to fight-41 or-flight physiology were likely key in facilitating a well-evidenced shift in the behavioural 42 ecology of our immediate chordate ancestors, and, in turn, the evolutionary success of 43 vertebrates. Still, the ox-CaMKII innovation for augmenting performance must be 44 considered a critical evolutionary trade-off, as it rendered us more susceptible to common 45 and often fatal diseases linked to excessive ROS. 46 examples include: a prechordal head with complex organs of special sensation and a fully 93 differentiated forebrain, a cartilaginous internal skeleton, muscular pharyngeal arches supporting 94 advanced respiration, a more powerful heart pumping blood containing haemoglobin-rich red-95 blood cells, and a sympathetic nervous system and elaborate endocrine glands supporting a fight-96 or-flight physiological response. Many of these novel functional complexes were developmental 97products of a newly evolved population of highly migratory and multipotent neural crest cells, 98and, ultimately, the entire suite of derived vertebrate features may well owe its existence to a 99 greatly expanded genetic tool kit made available by one, and possibly, two full rounds of genome 100 duplication 16 . At some level, all of these innovations promote an increasing level of activity that 101 must be enacted through the skeletal (striated) musculature; so, it was with the physiology of 102 skeletal muscle that we tested for potential beneficial effects of ox-CaMKII. 103 104CaMKII activity contributes to skeletal muscle function 17,18 , so we hypothesized that gaining the 105 MM motif allowed ROS to enhance skeletal muscle performance through ox-CaMKII. We set 106 out to test whether MM residues could dynamically respond to ROS in muscle fibres to increase 107CaMKII activity. To measure the dynamic change of CaMKII activity in muscle fibres, we 108 developed a fluorescent reporter that translocates from the nucleus to the cytosol in response to 109 increased activity of CaMKII (kinase translocation reporter, or KTR, Extended Data Fig. 3a and 110 b and Methods) 19 . We validated the reporter in RPE-1 cells by showing that it translocated into 111 the cytosol when the cells were treated by histamine (Extended Data Fig. 3c and d), which 112 transiently increased cytosolic Ca 2+ concentration 20 (data not shown). This translocation was 113 enhanced by co-expressed exogenous CaMKII, and blunted by co-expre...

show abstract

“…PCR primers were designed according to Hsuchou et al 55 for ObRa and ObRb receptors and Ko et al 71 for CCK-1 and CCK-2 receptors as follows: rat ObRa forward primer, TGAAGTATCTCATGACCACTACAGATGA; rat ObRa reverse primer, GTTTGCTTCCTTCCTTCAAAATGT; rat ObRb forward primer, GCATGCAGAATCAGTGATATTTGG; rat ObRb reverse primer, CAAGCTGTATCGACACTGATTTCTTC; rat CCK-1 receptor forward primer, CAGCAGGCCGGTGATAAGA; rat CCK-1 receptor reverse primer, GGTGGACATGAGAAGGTGT; rat CCK-2 receptor forward primer, CGCCATATGCCGACCACTG; rat CCK-2 receptor reverse primer, CCACACCCGGGATGAAGAAC; GAPDH forward primer, GGCACAGTCAAGGCTGAGAATG; GAPDH reverse primer, ATGGTGGTGAAGACGCCAGTA. Real time PCR was performed using the Rotor Gene 3000A system with a 72-well rotor, as described previously 72 .…”

Section: Methodsmentioning

confidence: 99%

Intracellular interplay between cholecystokinin and leptin signalling for satiety control in rats

Koizumi

Mohammad

Ozaki

et al. 2020

Sci Rep

Self Cite

View full text Add to dashboard Cite

Cholecystokinin (CCK) and leptin are satiety-controlling peptides, yet their interactive roles remain unclear. Here, we addressed this issue using in vitro and in vivo models. In rat C6 glioma cells, leptin pre-treatment enhanced ca 2+ mobilization by a CCK agonist (CCK-8s). This leptin action was reduced by Janus kinase inhibitor (AG490) or PI3-kinase inhibitor (LY294002). Meanwhile, leptin stimulation alone failed to mobilize ca 2+ even in cells overexpressing leptin receptors (C6-ObRb). Leptin increased nuclear immunoreactivity against phosphorylated STAT3 (pSTAT3) whereas CCK-8s reduced leptin-induced nuclear pSTAT3 accumulation in these cells. In the rat ventromedial hypothalamus (VMH), leptin-induced action potential firing was enhanced, whereas nuclear pSTAT3 was reduced by co-stimulation with CCK-8s. To further analyse in vivo signalling interplay, a CCK-1 antagonist (lorglumide) was intraperitoneally injected in rats following 1-h restricted feeding. Food access was increased 3-h after lorglumide injection. At this timepoint, nuclear pSTAT3 was increased whereas c-Fos was decreased in the VMH. Taken together, these results suggest that leptin and CCK receptors may both contribute to short-term satiety, and leptin could positively modulate CCK signalling. Notably, nuclear pSTAT3 levels in this experimental paradigm were negatively correlated with satiety levels, contrary to the generally described transcriptional regulation for long-term satiety via leptin receptors. Food intake control is essential for animal survival, and multiple signalling mechanisms are involved in intake behavior 1,2. Cholecystokinin (CCK), which is a peptide hormone secreted from the intestine in response to food intake 3-5 , is the classic satiety-controlling molecules 6,7. The dominant receptor subtypes, CCK-1 and CCK-2 receptors, are both G q-coupled seven-transmembrane receptors 8,9. CCK-1 receptors influence satiety, as CCK-1 agonists reduce food intake 10,11 whereas pharmacological blockage of CCK-1 receptors stimulate food intake 10,12-19. CCK-1 receptors are localized in peripheral and central machinery known to control satiety, and their dense expression has been found in the pylorus, nodose ganglion, nucleus tractus solitarius, and hypothalamic satiety-controlling centres 20. Both peripheral and central administration of CCK induce satiety responses 21,22 , although permeability of peripheral CCK to the brain is still a matter of controversy. Hypothalamic neurons contain high levels of CCK peptides 23,24 and the central role of CCK to suppress food intake is reported to be dependent on neural circuits expressing CCK-1 receptors 25-29. The function of hypothalamic CCK-1 receptors is supported by CCK-2 receptors, as demonstrated by their functional compensation evident in CCK-1 receptor knockout mice 30. Whether such direct receptor-wide interactions could be present among other receptors in the brain is currently unknown. In the present study, we investigated the intracellular interaction between CCK signaling and another ...

show abstract

Histamine Regulates Molecular Clock Oscillations in Human Retinal Pigment Epithelial Cells via H1 Receptors

Cited by 15 publications

References 39 publications

Rev-Erbα and Photoreceptor Outer Segments modulate the Circadian Clock in Retinal Pigment Epithelial Cells

Rev-Erbα and Photoreceptor Outer Segments modulate the Circadian Clock in Retinal Pigment Epithelial Cells

CaMKII oxidation is a performance/disease trade-off in vertebrate evolution

Intracellular interplay between cholecystokinin and leptin signalling for satiety control in rats

Contact Info

Product

Resources

About