Highly Specific Gene Silencing by Artificial MicroRNAs inArabidopsis

Abstract

Plant microRNAs (miRNAs) affect only a small number of targets with high sequence complementarity, while animal miRNAs usually have hundreds of targets with limited complementarity. We used artificial miRNAs (amiRNAs) to determine whether the narrow action spectrum of natural plant miRNAs reflects only intrinsic properties of the plant miRNA machinery or whether it is also due to past selection against natural miRNAs with broader specificity. amiRNAs were designed to target individual genes or groups of endogenous genes. Like natural miRNAs, they had varying numbers of target mismatches. Previously determined parameters of target selection for natural miRNAs could accurately predict direct targets of amiRNAs. The specificity of amiRNAs, as deduced from genome-wide expression profiling, was as high as that of natural plant miRNAs, supporting the notion that extensive base pairing with targets is required for plant miRNA function. amiRNAs make an effective tool for specific gene silencing in plants, especially when several related, but not identical, target genes need to be downregulated. We demonstrate that amiRNAs are also active when expressed under tissue-specific or inducible promoters, with limited nonautonomous effects. The design principles for amiRNAs have been generalized and integrated into a Web-based tool (http://wmd.weigelworld.org).

A calmodulin‐like protein regulates plasmodesmal closure during bacterial immune responses

“…To silence CML41 , an artificial micro RNA (amiRNA, 5′‐TAAACCGTCATCATTTGACCA‐3′) was designed against the CML41 mRNA sequence using Web Micro RNA Designer (W md 3, http://wmd3.weigelworld.org/cgi-bin/webapp.cgi) (Schwab et al ., 2006). Whilst a 2‐kb sequence upstream from the CML41 ATG start codon was amplified by PCR to represent the CML41 promoter ( proCML41 ).…”

Identification of conserved Aquilegia coerulea microRNAs and their targets

“…The near-perfect complementarity of plant miRNAs for their targets allows for very accurate prediction of miRNA targets (Rhoades et al, 2002;Jones-Rhoades and Bartel, 2004;Schwab et al, 2005;Schwab et al, 2006). All non-redundant A. coerulea mature miRNA sequences were used as the query in a BLASTn search of the Aquilegia Gene Index database, which consists of 85,039 reads (http://compbio.dfci.harvard.edu/tgi/cgibin/tgi/Blast/index.cgi).…”

Fine tuning of auxin signaling by miRNAs

“…This hypothesis was confirmed in a few plant species by two recent studies (Alvarez et al, 2006;Schwab et al, 2006) which demonstrated that amiRNAs specifically turn off their predicted targets. Both groups also found that amiRNAs were expressed in a specific manner by using inducible or tissue-specific promoters (Alvarez et al, 2006;Schwab et al, 2006). This suggests that amiRNAs can be designed to knock down several related, but not identical, targeted genes simultaneously.…”