Highly Sensitive Methods Based on Seminested Real-Time Reverse Transcription-PCR for Quantitation of Human Immunodeficiency Virus Type 1 Unspliced and Multiply Spliced RNA and Proviral DNA

Pasternak, Alexander; Adema, Karen; Bakker, Margreet; Jurriaans, Suzanne; Berkhout, Ben; Cornelissen, Marion; Lukashov, Vladimir V.

doi:10.1128/jcm.00055-08

Cited by 137 publications

(174 citation statements)

References 25 publications

(23 reference statements)

Supporting

Mentioning

161

Contrasting

Order By: Relevance

“…In contrast, elongated viral transcripts, which were amplified using a primer pair located between the U5 region of the LTR and the major splice donor site, were detected in the large RNA fractions from only 16 (9.8%) of the same patients (detection limit, ϳ500 copies/10 6 PBMCs). Although elongated transcripts were detected at higher rates in some previous studies using seminested qRT-PCR and TMA (15,17), we quantified viral transcripts by a single round of qRT-PCR in order to compare the detection rates of STs and elongated transcripts. These data suggest that, in our comparison of cell-based measurements, STs are a more sensitively detected target for monitoring viral transcription.…”

Section: Resultsmentioning

confidence: 99%

“…In particular, levels of intracellular viral RNA correlate with patients' conditions, such as rapid progression to AIDS (12)(13)(14). Recently, the methods to detect intracellular viral RNA have been improved using seminested quantitative reverse transcription-PCR (qRT-PCR), patientmatched PCR, or transcription-mediated amplification (TMA) (15)(16)(17); however, multiple steps are involved in these strategies. Furthermore, cell-associated viral RNA is still difficult to be detected, which could be due to the low percentage of HIV-1-infected cells among the circulating CD4 ϩ T cells (18,19), as well as premature termination of viral transcription.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Short Intracellular HIV-1 Transcripts as Biomarkers of Residual Immune Activation in Patients on Antiretroviral Therapy

Ishizaka

Sato

Nakamura

et al. 2016

J Virol

View full text Add to dashboard Cite

HIV-1 patients continue to remain at an abnormal immune status despite prolonged combination antiretroviral therapy (cART), which results in an increased risk of non-AIDS-related diseases. Given the growing recognition of the importance of understanding and controlling the residual virus in patients, additional virological markers to monitor infected cells are required. However, viral replication in circulating cells is much poorer than that in lymph nodes, which results in the absence of markers to distinguish these cells from uninfected cells in the blood. In this study, we identified prematurely terminated short HIV-1 transcripts (STs) in peripheral blood mononuclear cells (PBMCs) as an efficient intracellular biomarker to monitor viral activation and immune status in patients with cART-mediated full viral suppression in plasma. STs were detected in PBMCs obtained from both treated and untreated patients. ST levels in untreated patients generally increased with disease progression and decreased after treatment initiation. However, some patients exhibited sustained high levels of ST and low CD4؉ cell counts despite full viral suppression by treatment. The levels of STs strongly reflected chronic immune activation defined by coexpression of HLA-DR and CD38 on CD8 ؉ T cells, rather than circulating proviral load. These observations represent evidence for a relationship between viral persistence and host immune activation, which in turn results in the suboptimal increase in CD4؉ cells despite suppressive antiretroviral therapy. This cell-based measurement of viral persistence contributes to an improved understanding of the dynamics of viral persistence in cART patients and will guide therapeutic approaches targeting viral reservoirs. IMPORTANCECombination antiretroviral therapy (cART) suppresses HIV-1 load to below the detectable limit in plasma. However, the virus persists, and patients remain at an abnormal immune status, which results in an increased risk of non-AIDS-related complications. To achieve a functional cure for HIV-1 infection, activities of viral reservoirs must be quantified and monitored. However, latently infected cells are difficult to be monitored. Here, we identified prematurely terminated short HIV-1 transcripts (STs) as an efficient biomarker for monitoring viral activation and immune status in patients with cART-mediated full viral suppression in plasma. This cell-based measurement of viral persistence will contribute to our understanding of the impact of residual virus on chronic immune activation in HIV-1 patients during cART.

show abstract

Section: Resultsmentioning

confidence: 99%

mentioning

confidence: 99%

Short Intracellular HIV-1 Transcripts as Biomarkers of Residual Immune Activation in Patients on Antiretroviral Therapy

Ishizaka

Sato

Nakamura

et al. 2016

J Virol

View full text Add to dashboard Cite

show abstract

“…Total DNA and RNA were extracted from frozen tissues using the QIAamp DNA tissue minikit and the RNeasy isolation kit (both Qiagen), respectively. Tissue DNA and cDNA from MGT organs and spleen were subjected to a preamplification step followed by a quantitative real-time (TaqMan) PCR step, as previously described (52,53), with the following modifications. The two primer sets for gag and actin were the same for the preamplification and real-time PCR steps (SIVgag-F, GCCAGGATTTCAGGCACTGT; SIVgag-R, GCTTGATGGTCTCCCACACAA; Act-F, TACAGCTTCACC ACCACGG; Act-R, TGCTCGAAGTCTAGGGCGA).…”

Section: Methodsmentioning

confidence: 99%

Detection of Simian Immunodeficiency Virus in Semen, Urethra, and Male Reproductive Organs during Efficient Highly Active Antiretroviral Therapy

Matusali

Dereuddre-Bosquet

Tortorec

et al. 2015

J Virol

View full text Add to dashboard Cite

A number of men receiving prolonged suppressive highly active antiretroviral therapy (HAART) still shed human immunodeficiency virus (HIV) in semen. To investigate whether this seminal shedding may be due to poor drug penetration and/or viral production by long-lived cells within male genital tissues, we analyzed semen and reproductive tissues from macaques chronically infected with simian immunodeficiency virus mac251 (SIVmac251) who were treated for 4 months with HAART, which was intensified over the last 7 weeks with an integrase inhibitor. We showed that a subset of treated animals continued shedding SIV in semen despite efficient HAART. This shedding was not associated with low antiretroviral drug concentrations in semen or in testis, epididymis, seminal vesicles, and prostate. HAART had no significant impact on SIV RNA in the urethra, whereas it drastically reduced SIV RNA levels in the prostate and vas deferens and to a lesser extent in the epididymis and seminal vesicle. The only detectable SIV RNA-positive cells within the male genital tract after HAART were urethral macrophages. SIV DNA levels in genital tissues were not decreased by HAART, suggesting the presence throughout the male genital tract of nonproductively infected cells. In conclusion, our results demonstrate that 4 months of HAART induced variable and limited control of viral infection in the male reproductive organs, particularly in the urethra, and suggest that infected long-lived cells in the male genital tract may be involved in persistent seminal shedding during HAART. These results pave the way for further investigations of male genital organ infection in long-term-treated infected individuals. IMPORTANCEA substantial subset of men receiving prolonged HAART suppressing viral loads in the blood still harbor HIV in semen, and cases of sexual transmission have been reported. To understand the origin of this persistence, we analyzed the semen and male reproductive tissues from SIV-infected macaques treated with HAART. We demonstrated that persistent seminal shedding was not linked to poor drug penetration in semen or semen-producing prostate, seminal vesicle, epididymis, and testis. We revealed that HAART decreased SIV RNA to various extents in all male genital organs, with the exception of the urethra, in which SIV RNA ؉ macrophages were observed despite HAART. Importantly, HAART did not impact SIV DNA levels in the male genital organs. These results suggest that infection of male genital organs, and particularly the urethra, could be involved in the release of virus in semen during HAART.A pproximately 35.3 million people worldwide are living with human immunodeficiency virus (HIV)/AIDS, and 2.3 million new infections occur annually (1). Over 80% of these new infections are caused by unprotected sexual intercourse. The risk of sexual transmission of HIV is strongly correlated with HIV RNA levels in genital secretions (2). Because semen is the most common vector of HIV dissemination worldwide (3-5), preventing HIV transmission by...

show abstract

“…Many have also acknowledged that the proviral load may be an opportunity for early detection in adults in the 2-8 week window period [67] before seroconversion [61]- [63], a useful alternative for monitoring of ART when plasma RNA levels are undetectable [61], [68], [69], or a complement to the plasma RNA load for diagnostic or prognostic purposes [61], [68], [70]- [73]. Laboratory techniques for detection of proviral DNA have been described including nonquantitative PCR approaches [64], [74], quantitative PCR approaches [14], [61], [68], [69], [75], [76], electrochemiluminescencebased detection of PCR products [62], enzyme immunoassay detection of PCR products [63], and one study which performed PCR analysis on dried blood spots [60].…”

Section: A Current State Of the Artmentioning

confidence: 99%

“…However, assessment of levels of cell-associated unspliced and multiply spliced HIV RNA has also been suggested as clinical markers of disease progression [8]- [10], to have prognostic value [11], or to be useful metrics for assessing ART efficacy [12], [13]. Laboratory-based methods for the detection of cell-associated RNA have been demonstrated [14], [15].…”

mentioning

confidence: 99%

Micro- and Nanotechnology for HIV/AIDS Diagnostics in Resource-Limited Settings

Damhorst

Watkins

Bashir

2013

IEEE Trans. Biomed. Eng.

View full text Add to dashboard Cite

Highly Sensitive Methods Based on Seminested Real-Time Reverse Transcription-PCR for Quantitation of Human Immunodeficiency Virus Type 1 Unspliced and Multiply Spliced RNA and Proviral DNA

Cited by 137 publications

References 25 publications

Short Intracellular HIV-1 Transcripts as Biomarkers of Residual Immune Activation in Patients on Antiretroviral Therapy

Short Intracellular HIV-1 Transcripts as Biomarkers of Residual Immune Activation in Patients on Antiretroviral Therapy

Detection of Simian Immunodeficiency Virus in Semen, Urethra, and Male Reproductive Organs during Efficient Highly Active Antiretroviral Therapy

Micro- and Nanotechnology for HIV/AIDS Diagnostics in Resource-Limited Settings

Contact Info

Product

Resources

About