High throughput method of 16S rRNA gene sequencing library preparation for plant root microbial community profiling

Abstract

Microbiota are a major component of agroecosystems. Root microbiota, which inhabit the inside and surface of plant roots, play a significant role in plant growth and health. As next-generation sequencing technology allows the capture of microbial profiles without culturing the microbes, profiling of plant microbiota has become a staple tool in plant science and agriculture. Here, we have increased sample handling efficiency in a two-step PCR amplification protocol for 16S rRNA gene sequencing of plant root microbiota, improving DNA extraction using AMPure XP magnetic beads and PCR purification using exonuclease. These modifications reduce sample handling and capture microbial diversity comparable to that obtained by the manual method. We found a buffer with AMPure XP magnetic beads enabled efficient extraction of microbial DNA directly from plant roots. We also demonstrated that purification using exonuclease before the second PCR step enabled the capture of higher degrees of microbial diversity, thus allowing for the detection of minor bacteria compared with the purification using magnetic beads in this step. In addition, our method generated comparable microbiome profile data in plant roots and soils to that of using common commercially available DNA extraction kits, such as DNeasy PowerSoil Pro Kit and FastDNA SPIN Kit for Soil. Our method offers a simple and high-throughput option for maintaining the quality of plant root microbial community profiling.

First report of target spot on tomato caused by Corynespora cassiicola in Nepal

“…DNA was extracted from week‐old mycelia of pure cultures using AMPure XP beads (Beckman Coulter, UK) (Kumaishi et al., 2022). The internal transcribed spacer region of rDNA was amplified with the ITS4/ITS5 primers and sequenced.…”

“…DNA was extracted from week-old mycelia of pure cultures using AMPure XP beads (Beckman Coulter, UK) (Kumaishi et al, 2022) ITS4/ITS5 primers and sequenced. PCR amplifications were performed using the ITS4/ITS5 primer pair (White et al 1990).…”

First report of Tomato leaf curl New Delhi virus in tomato in Nepal

“…To confirm the diagnosis, DNA was extracted from the leaves using AMPure XP beads (Beckman Coulter, UK) (Kumaishi et al. , 2022). PCR was conducted using ToLCNDV‐specific primers ToLCNDV‐up (5′‐GAACTATGGTGAAGCGACCAGCAGA‐3′) and ToLCNDV‐do (5′‐ACACAGGTCCTTAGGTACCTGG‐3′) (Alfaro‐Fernández et al.…”

“…Ten diseased leaves, one per plant from five plants each from Kavrepalanchok and Lamjung, were collected and tested postitive with an Immunostrip (Agdia, USA) specific to ToLCNDV. To confirm the diagnosis, DNA was extracted from the leaves using AMPure XP beads (Beckman Coulter, UK) (Kumaishi et al, 2022).…”

Comparative analysis of microbial community structure in different times of Panax ginseng Rhizosphere microbiome and soil properties under larch forest

“…Microbiota is a major component of agroecosystems [ 6 ]. As the most active component in the soil ecosystem, soil microorganisms can improve physical and chemical properties and regulate soil nutrition through their activities [ 7 , 8 ].…”