High Catalytic Activity of Human Cytochrome P450 Co-expressed with Human NADPH-Cytochrome P450 Reductase in Escherichia coli

Iwata, Hiroshi; Fujita, Ken‐ichi; Kushida, Hirotaka; Suzuki, Akihiro; Konno, Yuko; Nakamura, Katsunori; Fujino, Akiharu; Kamataki, Tetsuya

doi:10.1016/s0006-2952(97)00643-6

Cited by 147 publications

(114 citation statements)

References 62 publications

Supporting

Mentioning

112

Contrasting

Order By: Relevance

“…For protein expression, a bicistronic plasmid carrying cynomolgus CYP2B6 and human NADPH-CYP reductase cDNAs was generated as described previously [5,15], except that modification of the N-terminus was accomplished by PCR using the primers 5'-GGAATTC CATATGGCTCTGTTATTAGCAGTTTTTCTTGCACTC CTTACAGGCCTC-3' and 5'-GCTCTAGACTTCAGCGG GGCAGGAA-3', which contained the NdeI and XbaI sites (underlined), respectively. These restriction enzyme sites were utilized for subcloning of the amplified products into the vector.…”

Section: Identification and Characterization Of Cyp2b6 Cdna In Cynomomentioning

confidence: 99%

“…These restriction enzyme sites were utilized for subcloning of the amplified products into the vector. With the resultant plasmid, protein expression was carried out in E. coli according to a method described elsewhere [5,15]. From the E. coli cells, membrane fractions were prepared as described by Sandhu et al [12].…”

Section: Identification and Characterization Of Cyp2b6 Cdna In Cynomomentioning

confidence: 99%

See 1 more Smart Citation

Identification and Characterization of CYP2B6 cDNA in Cynomolgus Macaques (Macaca fascicularis)

Uno

Matsuno

Nakamura

et al. 2009

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

ABSTRACT. Cytochrome P450 2B6 (CYP2B6), an important drug-metabolizing enzyme, is involved in the metabolism of prescribed drugs in humans. Despite its importance, cDNA for a CYP2B6 ortholog has not been identified and characterized in cynomolgus macaques, which are frequently used in preclinical studies. In this study, cDNA highly homologous to human CYP2B6 was cloned from the cynomolgus macaque liver. This cDNA contained an open reading frame of 491 amino acids and functional domains characteristic for CYP protein, such as substrate recognition sites and a heme-binding region. Cynomolgus CYP2B6 was expressed predominantly in the liver with some extra-hepatic expression among 10 tissues. Moreover, cynomolgus CYP2B6 revealed activities toward testosterone 16-hydroxylation and bupropion hydroxylation. These results suggest that cynomolgus CYP2B6 has a functional role in the liver.

show abstract

Section: Identification and Characterization Of Cyp2b6 Cdna In Cynomomentioning

confidence: 99%

Section: Identification and Characterization Of Cyp2b6 Cdna In Cynomomentioning

confidence: 99%

Identification and Characterization of CYP2B6 cDNA in Cynomolgus Macaques (Macaca fascicularis)

Uno

Matsuno

Nakamura

et al. 2009

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

show abstract

“…Total RNA was extracted from Escherichia coli transfected with human CYP1A1 or 1A2. 10) CYP1A1 and 1A2 gene expression levels were measured individually using CYP1A1 and 1A2 specific primer and probe sets.…”

Section: )mentioning

confidence: 99%

Cytochrome P450 gene expression levels in peripheral blood mononuclear cells in comparison with the liver

et al. 2004

Self Cite

View full text Add to dashboard Cite

Cytochromes P450 (CYPs) compose a superfamily of similar proteins involved in detoxification and elimination, as well as activation of a wide variety of compounds. Most CYP family members are localized in the liver. In order to assess whether peripheral blood leukocytes (PBL) are available as a surrogate for the determination of CYP gene expression levels in the liver, we compared CYP gene expression levels in PBL with those in liver tissues from patients with hepatocellular carcinoma (HCC). We measured CYP1A1, 1A2, 1B1, 2A6, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 3A4, 3A5, etabolism of foreign compounds in the body to polar, hydrophilic metabolites is an important prerequisite for detoxification and elimination of xenobiotics from the body. The cytochromes P450 (CYPs) are a superfamily of similar heme-containing proteins that are involved in the oxidative metabolism of xenobiotics. CYPs also catalyze the bioactivation and inactivation of a wide variety of endogenous compounds, including steroid hormones and eicosanoids. Most of the CYP family members are located in the liver.1-3) Many environmental factors, stress, drugs and diseases influence the expression levels of CYP family members, which may lead to alterations of hepatic drug metabolism in man. Studies on such alterations generally require systemic administration of a drug or probe substance and the application of standard pharmacokinetic approaches. 4,5) Although small amounts of needle biopsy material from the liver can be used for assessment of gene expression, the process of biopsy is accompanied by practical and ethical problems. Some CYPs are also expressed in extra-hepatic tissues such as the lung, the kidney and the small intestine. Although xenobiotics are transported via the blood and peripheral blood is obtained for routine medical examination, little is known about CYP expression in peripheral blood cells. So far, CYP1A1, 1B1, 2D6, 2E1 and 3A genes have been shown to be expressed in peripheral blood.6, 7) In order to determine whether peripheral blood leukocytes (PBL) are applicable as a surrogate for assessment of CYP gene expression in the liver, we measured CYP gene expression levels in PBL and the liver, and studied the intra-individual correlation between them. Approximately 70% of human liver CYPs is accounted for by CYP1A2, 2A6, B6, 2C, 2D6, 2E1 and 3A.8) Here, we measured the expression levels of 19 CYP genes, i.e., CYP1A1, 1A2, 1B1, 2A6, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 3A4, 3A5, 3A7, 4A11, 4B1 and CYP27, by real-time reverse-transcription (RT)-PCR. Furthermore, we compared the CYP gene expression levels in tumor and non-tumor tissues from liver cancers to assess whether carcinogenesis is associated with specific changes in CYP gene expression levels or not. Materials and MethodsWe investigated 18 patients with hepatocellular carcinoma (HCC), 2 patients with intrahepatic cholangiocarcinoma (ICC), 2 with bile duct cancer (BDK) and 1 with colon cancer metastasized to the liver (META) who underwent surgical r...

show abstract

“…To determine drug-metabolizing activity, cynomolgus CYP2C18 protein was heterologously expressed in E. coli as described previously [6,20]. Briefly, for modification of the N-terminus, PCR was carried out using the primers 5'-GGAATTCCATATGGCTCTGTTATTAGCAGTTTTT CTCTGTCTCTCCTGTTTG-3' and 5'-GCTCTAGACCA-GACCATCTGCCCTTCTT-3', where the nucleotide sequences underlined were the NdeI and XbaI sites, respectively.…”

mentioning

confidence: 99%

“…These sites were utilized for subsequent subcloning of the PCR product into the pCW vector, which was designed to co-express the human NADPH-CYP reductase. Protein expression was carried out with the generated plasmid as described previously [6]. Membrane fractions were prepared from the E. coli cells according to a previously reported method [17].…”

mentioning

confidence: 99%

Identification and Characterization of CYP2C18 in the Cynomolgus Macaque (Macaca fascicularis)

Uno

Matsuno

Nakamura

et al. 2010

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

ABSTRACT. The macaque is widely used for investigation of drug metabolism due to its evolutionary closeness to the human. However, the genetic backgrounds of drug-metabolizing enzymes have not been fully investigated; therefore, identification and characterization of drug-metabolizing enzyme genes are important for understanding drug metabolism in this species. In this study, we isolated and characterized a novel cytochrome P450 2C18 (CYP2C18) cDNA in cynomolgus macaques. This cDNA was highly homologous (96%) to human CYP2C18 cDNA. Cynomolgus CYP2C18 was preferentially expressed in the liver and kidney. Moreover, a metabolic assay using cynomolgus CYP2C18 protein heterologously expressed in Escherichia coli revealed its activity toward S-mephenytoin 4'-hydroxylation. These results suggest that cynomolgus CYP2C18 could function as a drug-metabolizing enzyme in the liver.KEY WORDS: cloning, CYP2C18, cytochrome P450, liver, monkey.J. Vet. Med. Sci. 72(2): 225-228, 2010 Cytochrome P450 (CYP) is a superfamily of some of the most important drug-metabolizing enzymes and consists of a large number of subfamilies [14]. In humans, the CYP2C subfamilies contain important enzymes that metabolize approximately 20% of all prescribed drugs [3]. In the CYP2C subfamily, CYP2C8, CYP2C9 and CYP2C19 are highly expressed in the liver, whereas protein expression of human CYP2C18 has not been seen at a detectable level in the liver [3]. CYP2C8, CYP2C9 and CYP2C19 exhibit metabolic activities toward clinically important drugs; the anticancer drug paclitaxel is metabolized by CYP2C8; the hypoglycemic agent tolbutamide, nonsteroidal anti-inflammatory drug diclofenac, anticonvulsant phenytoin and anticoagulant warfarin are metabolized by CYP2C9; and the antiulcer drug omeprazole and the anticonvulsant drug mephenytoin are metabolized by CYP2C19 [3]. All human CYP2Cs exhibit genetic polymorphisms. In particular, some genetic polymorphisms of CYP2C9 and CYP2C19 have been shown to result in toxicity or altered efficacy of drugs in humans.In cynomolgus macaques, which are used to evaluate drug effects and toxicities in preclinical studies of drug development, cDNAs for CYP2C20, CYP2C43, CYP2C75 and CYP2C76 have been identified [9,20]. CYP2C20 cDNA is highly homologous (95%) to human CYP2C8 cDNA, while CYP2C43 and CYP2C75 cDNAs are highly homologous (93-95%) to both human CYP2C9 and CYP2C19 cDNAs. CYP2C76 cDNA shows only 75-76% sequence identity to human CYP2Cs. CYP2C76 is not orthologous to any human CYPs [20] and is partly responsible for the difference of drug metabolism between cynomolgus macaques and humans [21]. Such species differences also could be explained by functional disparity of the orthologous CYPs between the two species, such as, if an ortholog to human CYP with low (or no) expression and drug-metabolizing activity, for example CYP2C18, shows abundant expression and substantial activity in cynomolgus macaques. To investigate this possibility, in this study, we isolated cynomolgus CYP2C18 cDNA encoding an ortholog of human C...

show abstract

High Catalytic Activity of Human Cytochrome P450 Co-expressed with Human NADPH-Cytochrome P450 Reductase in Escherichia coli

Cited by 147 publications

References 62 publications

Identification and Characterization of CYP2B6 cDNA in Cynomolgus Macaques (Macaca fascicularis)

Identification and Characterization of CYP2B6 cDNA in Cynomolgus Macaques (Macaca fascicularis)

Cytochrome P450 gene expression levels in peripheral blood mononuclear cells in comparison with the liver

Identification and Characterization of CYP2C18 in the Cynomolgus Macaque (Macaca fascicularis)

Contact Info

Product

Resources

About