High Allelic Diversity of the DRB3 Gene (MHC Class II) in Saiga (Saiga tatarica) L., 1766), Obtained by Next Generation Sequencing Method

The modern state of the European saiga population (Saiga tatarica tatarica): mtDNA, DRB3 MHC gene, and microsatellite diversity

“…3). In addition to the previously described seven alleles, MF960850-MF960856 (Tarasyan et al 2019), three more new alleles for saiga were identified when the sampling was enlarged. These alleles were placed in NCBI under MT150329-MT150331.…”

“…To describe the allelic diversity of the DRB3 gene of MHC, we analyzed 30 saigas' samples: 12 obtained earlier (Tarasyan et al 2019) and 18 new ones. PCR was performed in 50 μL volumes with the final concentration of 0.05 mM of each dNTP, 2.5 mM of MgCl 2 , 0.5 picomoles of the forward and reverse primers, 1 unit of Hot Start Taq DNA and 0.25 unit pFUSE DNA polymerase (SibEnzyme, Russia), 1× PCR buffer and 1.0 μL of DNA extract with La31 primers (5 -GATGGATCCTCTCTCTGCAGCACATTTCCT-3 ) and La32 (5 -CTTGAATTCGCGCTCACCTCGCCGCTG-3 ), and with primer La 31 and modified primer with adapter La32-mid: ATAGACTATACTCTTGAATTCG CGCTCACCTCGCCGCTG, for which it had been shown to effectively amplify the DRB3 gene in different ungulate species (Mikko et al 1999;Kennedy et al 2010;Taylor et al 2012) in the previously described mode (Mikko et al 1999).…”

“…Tarasyan and colleagues developed a method to assess the DRB3 gene polymorphism for saiga (Tarasyan et al. 2019).…”

“…Investigations are on-going in Mongolia devoted to the Mongolian saiga subspecies' genetic diversity using the mtDNA analysis (Sod-Erdene et al 2018). Tarasyan and colleagues developed a method to assess the DRB3 gene polymorphism for saiga (Tarasyan et al 2019).…”