Hierarchies of base pair preferences in the P22 ant promoter

Abstract

Oligonucleotide-directed mutagenesis was used to complete a collection of mutations in the -35 and -10 hexamers of the ant promoter of Salmonella phage P22. The effects of all 36 single-base-pair substitutions on promoter strength in vivo were measured in strains carrying the mutant promoters fused to an ant-lacZ gene on a single-copy prophage. The results of these assays show that certain consensus base pairs are more important than others; in general, the least-critical positions are among the most poorly conserved. Some mutations within the hexamers have smaller effects on promoter strength than certain mutations outside the hexamers in this and other promoters. Several different patterns of base pair preferences are observed. These hierarchies of base pair preferences correlate well (but not perfectly) with the hierarchies defined by the frequency distribution of base pairs at each position among wild-type promoters. The hierarchies observed in the ant promoter also agree well with most of the available information on base pair preferences in other promoters.The first step of transcription initiation is the association of RNA polymerase with a promoter sequence on the DNA. In eubacteria, promoter specificity is determined by a family of protein subunits called sigma (a) factors, which associate with the core enzyme (%2WB') to form the holoenzyme. The major sigma factor of Escherichia coli and Salmonella typhimurium is 70, a 70-kDa protein required for recognition of most promoters. Other classes of promoters are recognized by holoenzymes containing minor sigma factors (16).Comparisons of numerous a70-dependent promoters controlling chromosomal, plasmid, transposon, and phage genes in E. coli and S. typhimurium revealed two regions of conserved DNA sequence located approximately 10 and 35 bp upstream of the start site of transcription. Each region has a 6-bp consensus sequence, the -10 and -35 hexamers 5'-TATAAT-3' and 5'-TTGACA-3', respectively. Weakly conserved positions outside the hexamers have varied considerably in different compilations ( Fig. 1) (14,15,32). The hexamers are separated by a spacer region with a preferred length of 17 bp. Recent genetic studies strongly suggest that both regions of the promoter are directly contacted by sigma factors (8,11,23,34,41,47).Evidence that the hexamers are important determinants of promoter strength has been obtained by the analysis of promoter mutations, most of which affect base pairs within the hexamers (15). In most cases, mutations that decrease promoter activity are changes away from consensus, while mutations that increase promoter activity are changes toward consensus. Various exceptions to this rule are discussed below. Kinetic studies of several promoters show that mutations in the hexamers affect the rate parameters for early steps in the interaction between the promoter and RNA polymerase, the formation of an initial, "closed" complex and/or isomerization to a transcriptionally active, "open" complex (18, 39; for a review see reference 29). of at le...

Interaction of RNA polymerase with forked DNA: Evidence for two kinetically significant intermediates on the pathway to the final complex

“…This result is consistent with the observation that TG sequences at equivalent positions of promoter DNA increase the extent of open complex formation by affecting a step subsequent to the formation of the closed complex (25). The substitution of the consensus G at Ϫ33 by a C was reported to be detrimental to promoter function (26,27). It leads to a severely reduced ability of the wt Fork to bind RNAP in the absence of heparin and undetectable binding in its presence (data not shown).…”

Contribution of 16S rRNA nucleotides forming the 30S subunit A and P sites to translation inEscherichia coli

“…A DNA fragment containing a variant of the P ant promoter (Moyle et al 1991) and the altered SD sequence 5 0 -ATCCC-3 0 (Lee et al 1996) was generated by annealing oligonucleotide #3 (5 0 -GGAATTCAC TAGTTTGAAATGAATGAAGCACTCTACTATATTCTTAATAGG TCC-3 0 ) with #5 (5 0 -CGGGATCCATTTCTCGAGGGATATGAT AGTCAAACAGGACCTATTAAG-3 0 ) and extending with Sequenase (USB Corporation) and dNTPs (Rossi et al 1982). This fragment was digested with EcoRI and BamHI and cloned upstream of lacZ in pRS552, and the resulting fusion was transferred to lRS45 by homologous recombination in vivo (Simons et al 1987).…”

Characterization of 16S rRNA mutations that decrease the fidelity of translation initiation

“…Each strain contained the lacZ gene (with the alternative SD sequence 59-ATCCC-39) in single copy on the chromosome. To construct these strains, DNA fragments containing a consensus variant of the P ant promoter (Moyle et al 1991), the alternative SD sequence 59-ATCCC-39, and a start codon (ATG, ACG, ATC, or CTG) were generated as described (Abdi and Fredrick 2005). These fragments were digested with EcoRI and BamHI and cloned upstream of lacZ in pRS552, and the resulting fusions were transferred to lRS45 by homologous recombination in vivo (Simons et al 1987).…”