Heterozygote of TAP1 Codon637 decreases susceptibility to HPV infection but increases susceptibility to esophageal cancer among the Kazakh populations

Abstract

BackgroundThe role of human papillomavirus (HPV) may be involved in the development of esophageal cancer (EC) and the polymorphic immune response gene transporter associated with antigen processing (TAP) may be involved in HPV persistence and subsequent cancer carcinogenesis. The current study aims to provide association evidence for HPV with EC, to investigate TAP1 polymorphisms in EC and assess its association with HPV statuses and EC in Kazakhs.MethodsThe HPV genotypes in 361 patients with EC and 66 controls selected from Kazakh population were evaluated using PCR. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to detect two SNPs of TAP1 in 150 cases comprised of 75 HPV+ and 75 HPV- patients and 283 pure ethnic population of Kazakh and evaluate their associations with susceptibility to EC. A case-to-case comparison based on the genotyping results was conducted to address the function of TAP1 variants in the involvement of HPV.ResultsThe presence of four HPV genotypes in EC tissues ― including HPV 16, 18, 31, 45 ― was significantly higher at 64.6 % than those in controls at 18.2 % (P < 0.001). Such presence was strongly associated with increased risk of EC (OR 8.196; 95 % CI 4.280–15.964). The infection of HPV16, and multi-infection of 16 and 18 significantly increase the risk for developing EC (OR 4.616, 95 % CI 2.099–10.151; and OR 6.029, 95 % CI 1.395–26.057 respectively). Heterozygote of TAP1 D637G had a significantly higher risk for developing EC (OR 1.626; 95 % CI 1.080–2.449). The odds ratio for HPV infection was significantly lower among carriers of TAP1 D637G polymorphism (OR 0.281; 95 % CI 0.144–0.551).ConclusionsHPV infection exhibits a strong positive association with the risk of EC in Kazakhs. Heterozygote of TAP1 D637G decreases susceptibility to HPV infection in patients with EC but increases susceptibility to EC among the Kazakh populations.

p53 expression but not p16INK4A correlates with human papillomavirus-associated esophageal squamous cell carcinoma in Kazakh population

“…HPV positivity was detected in 45.5 % of ESCC patients in this study, which is similar with previously reported data in Kazakhs [ 10 – 12 ], with a prevalence ranging from 30 % to 66.67 %. No correlation was observed between HPV positivity and clinicopathological characteristics, which is in agreement with previous studies on ESCC [ 51 ].…”

“…HPV DNA was detected as previously described [ 12 ]. Non-degenerate primer sets GP5+/6+ (forward: TTGGATCCTTTGTACTGTGGTAGATACTAC and reverse: TTGGATCCGAAAAATAAACTGTAAATCATATTC) amplifying a 150 bp fragment within L1 gene of a wide range of HPV types were used.…”

“…Few studies searched for mucosal as well as cutaneous HPV sequences in esophageal lesions [ 9 ]. Recently it has been reported that the HPV prevalence in ESCC of Kazakh patients ranged from 30 % to 66.67 % [ 10 – 12 ]. For such reason the identification of HPV status in the ESCC lesions is important to establish their etiology and prognostic significance [ 13 ].…”

Genetic variability in LMP2 and LMP7 is associated with the risk of esophageal squamous cell carcinoma in the Kazakh population but is not associated with HPV infection

“…Our previous studies found that TAP1 polymorphisms could increase susceptibility to ESCC in the Kazakh population [ 35 ]. Moreover, TAP1, LMP2 and LMP7 are all located within a narrow region of the class II cluster of the major histocompatibility complex on chromosome 6 [ 14 ].…”

“…One study reported an infection rate of 100%, which was confirmed by detection of the HPV16 E6 and E7 genes in a high-risk area in Anyang, Henan [ 37 ]. Some reports even found that HPV infection is an important factor contributing to the high incidence of ESCC in the Kazakh population in Xinjiang [ 35 ]. Indeed, a study on cervical cancer showed that the genetic makeup of host immune response genes may be responsible for biological variability to HPV infection [ 38 ].…”