Heterogeneous nuclear ribonucleoprotein A1 regulates rhythmic synthesis of mouse Nfil3 protein via IRES-mediated translation

Abstract

Nuclear factor, interleukin 3, regulated (Nfil3, also known as E4 Promoter-Binding Protein 4 (E4BP4)) protein is a transcription factor that binds to DNA and generally represses target gene expression. In the circadian clock system, Nfil3 binds to a D-box element residing in the promoter of clock genes and contributes to their robust oscillation. Here, we show that the 5′-untranslated region (5′-UTR) of Nfil3 mRNA contains an internal ribosome entry site (IRES) and that IRES-mediated translation occurs in a phase-dependent manner. We demonstrate that heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) binds to a specific region of Nfil3 mRNA and regulates IRES-mediated translation. Knockdown of hnRNP A1 almost completely abolishes protein oscillation without affecting mRNA oscillation. Moreover, we observe that intracellular calcium levels, which are closely related to bone formation, depend on Nfil3 levels in osteoblast cell lines. We suggest that the 5′-UTR mediated cap-independent translation of Nfil3 mRNA contributes to the rhythmic expression of Nfil3 by interacting with the RNA binding protein hnRNP A1. These data provide new evidence that the posttranscriptional regulation of clock gene expression is important during bone metabolism.

hnRNP Q Regulates Internal Ribosome Entry Site-Mediated fmr1 Translation in Neurons

“…The 5= UTR of mouse fmr1 (NM_008031.2) (https://www.ncbi.nlm.nih.gov/ nuccore/NM_008031.2/) (AGGAGGCGCAGCGGAGCCCTTGGCCTCAGTCAGTCAGGCGCTGGGGAGCGTTTCG GTTTCACTTCCGGTGAGGGGCCGCGCCTGAGAGGGCGGGCAGTGAAGCAAACGGACGGCGAGCGCGGGCGGT GGCAGTGACGGCGGCGCCGCTGCCGGGGGGCGTGCGGTAACGCGGCGGCGGCGGCGGCGGCGACGGCGGCT GGGCCTCAAGCGCCTGCAGCCCACCTCCCGGAGGCGGGCTCCCGGCGCGAGGACGGACGAGAAG) was amplified from cDNA using PFU polymerase (Solgent) and was confirmed by sequencing. All the PCR products were digested with SalI/XmaI restriction enzymes (Beams) and inserted into the intercistronic region of a pRF bicistronic vector that contained both RLUC and FLUC (19,20,24,30). For the pRF bicistronic vector with the promoter deleted (ΔCMV_5=UTR), the CMV promoter was removed from the pRF bicistronic vector by digestion with BglIII/NheI restriction enzymes and self-ligation.…”

Transcriptional activation of DBP by hnRNP K facilitates circadian rhythm

“…Endogenous mRNA levels were detected by quantitative real-time PCR using the StepOnePlus real-time PCR system (Applied Biosystems) with FastStart Universal SYBR Green Master (Roche), as described previously (65). Specific primer pairs for mouse Dbp (NM_016974.3), mouse pre-Dbp which primers targeted for intron regions (4), mouse Per1 (NM_011065.5 mouse Per2 (NM_011066.3), mouse Rev-erbα (NM_145434.4), mouse Hlf (NM_172563.3), mouse Tef (NM_017376.3), mouse Nfil3 (NM_017373.3) (18), mouse Bmal1 (NM_007489.4), mouse Per3 (NM_001289877.1) (20), mouse Cry1 (NM_007771.3), mouse Cry2 (NM_009963.4), human hnRNP K (NM_002140.4), and human DBP (NM_001352.4) were used for real-time PCR (the primer sequences are shown in Supplementary Table S1).…”

“…Several studies have reported that clock genes are controlled by core genes such as the BMAL1-CLOCK complex, which acts as an activator (5, 6), and Cryptochrome (Cry1 and Cry2) (7, 8) along with Period (Per1, Per2, and Per3) (9-12) genes, which function as repressors. Recently, post-transcriptional regulation of clock genes by RNA-binding proteins such as hnRNP Q (13-15), PTB (16), hnRNP D (17), hnRNP A1 (18), hnRNP R (19), and hnRNP K (20) was shown to play a role in circadian rhythm.…”

Seasonal temperature, the lunar cycle and diurnal rhythms interact in a combinatorial manner to modulate genomic responses to the environment in a reef‐building coral

“…Solid lines represent the mean counts (log 2 ), shaded areas (blue and red) are 95% confidence intervals, and grey areas denote nighttime. Hour indicates local clock hour (time of day) been demonstrated to regulate mef2 expression and splicing in mammalian cells and also exerts post-transcriptional control over multiple biological clock genes such as vrille/Nfil3 (Kim et al, 2017). A second heterogeneous nuclear ribonucleoprotein (hnRNP) responding to all three variables, the hnrnpk gene (p = .006), also regulates splicing and interacts with biological clocks (Nolte & Staiger, 2015).…”