Heterogeneity in ess transcriptional organization and variable contribution of the Ess/Type VII protein secretion system to virulence across closely related Staphylocccus aureus strains

Abstract

The Type VII protein secretion system, found in Gram-positive bacteria, secretes small proteins, containing a conserved W-x-G amino acid sequence motif, to the growth medium. Staphylococcus aureus has a conserved Type VII secretion system, termed Ess, which is dispensable for laboratory growth but required for virulence. In this study we show that there are unexpected differences in the organization of the ess gene cluster between closely related strains of S. aureus. We further show that in laboratory growth medium different strains of S. aureus secrete the EsxA and EsxC substrate proteins at different growth points, and that the Ess system in strain Newman is inactive under these conditions. Systematic deletion analysis in S. aureus RN6390 is consistent with the EsaA, EsaB, EssA, EssB, EssC and EsxA proteins comprising core components of the secretion machinery in this strain. Finally we demonstrate that the Ess secretion machinery of two S. aureus strains, RN6390 and COL, is important for nasal colonization and virulence in the murine lung pneumonia model. Surprisingly, however, the secretion system plays no role in the virulence of strain SA113 under the same conditions.

Membrane interactions and self‐association of components of the Ess/Type VII secretion system of Staphylococcus aureus

“…A plasmid construct producing N‐terminally hexahistidine‐tagged EsaA has been described previously 3. Plasmid pEssB‐nhis encodes N‐terminally hexahistidine‐tagged EssB was constructed as follows: the essB coding region was amplified from RN6390 genomic DNA using primers: 5′‐GATAGATCTGTTAAAAATCATAACCCTAAAAATG‐3′ and 5′‐CGAGAATTCACTATTTTTTT.…”

“…SDS PAGE was carried out using Bis‐Tris gels as described previously 3, and western blotting was performed following standard protocols with the following antibody dilutions: α‐EsxA 3 1 : 2500, α‐EsxC 3 1 : 2000, α‐EsaA 3 1 : 10 000, α‐EssB 3 1 : 10 000, α‐EssC 3 1 : 10 000 and α‐TrxA 13 1 : 10 000.…”

Comparative genome analysis of Streptococcus iniae DX09 reveals new insights into niche adaptation and competitive host colonisation ability

“…T7SS was initially described and termed the 'ESX protein secretion system' in pathogenic mycobacteria [23] belonging to the class Actinobacteria with high GC content. Subsequently, a related secretion system (ESS protein secretion) was detected in some Firmicutes bacteria, including Staphylococcus aureus [24][25][26][27][28][29], Listeria monocytogenes [21,30], Bacillus subtilis [21,30] and Streptococcus agalactiae [21,30]. We have identified an ESS secretion system in S. iniae, which also belongs to the low-GC Firmicutes bacterial group.…”

“…Previous investigations have demonstrated a crucial role of T7SS in bacterial survival within the host [21,23,31,32], consistent with transmission electron micrographs of interactions between S. iniae DX09 and spleen cells from diseased catfish. Moreover, considerable evidence is available supporting essential roles of the actinobacterial ESS protein secretion system in virulence [26][27][28][29].…”

A large soluble domain of the Staphylococcus aureus ESAT-6 Virulence Factor EsaA is stable in the absence of its cognate transmembrane domains

“…ESAT-6 (early secreted antigenic targets of 6 kDa) or Type VII Secretion System (T7SS) is a specialized secretion system that contributes to S. aureus virulence [5]. It is evolutionarily related to the ESX-1 secretion system, initially identified in Mycobacterium tuberculosis during the isolation of the BCG vaccine strain Mycobacterium bovis [6].…”