Heterogeneity in Genetic Diversity among Non-Coding Loci Fails to Fit Neutral Coalescent Models of Population History

Peters, Jeffrey L.; Roberts, Trina E.; Winker, Kevin; McCracken, Kevin G.

doi:10.1371/journal.pone.0031972

Cited by 28 publications

(65 citation statements)

References 94 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Furthermore, Kuchi showed the lowest genetic diversity among the Tanzanian chicken populations investigated. This finding might be a result of recent isolation of this population from an ancestral population (Crow, 1986;Manthey, 2011;Peters et al, 2012). A low genomic evolutionary rate and elevated inbreeding frequency may have contributed to the low genetic variation observed in this population.…”

Section: Discussionmentioning

confidence: 83%

Assessing the genetic diversity of five Tanzanian chicken ecotypes using molecular tools

Lyimo¹,

Weigend²,

Janssen-Tapken³

et al. 2014

SA J. An. Sci.

View full text Add to dashboard Cite

The study aimed to evaluate the genetic diversity of Tanzanian chicken populations through phylogenetic relationship, and to trace the history of Tanzanian indigenous chickens. Five ecotypes of Tanzanian local chickens (Ching'wekwe, Kuchi, Morogoro-medium, Pemba and Unguja) from eight regions were studied. Diversity was assessed based on morphological measurements and 29 microsatellite markers recommended by ISAG/FAO advisory group on animal genetic diversity. A principal component analysis (PCA) of morphological measures distinguished individuals most by body sizes and body weight. Morogoro Medium, Pemba and Unguja were grouped together, while Ching'wekwe stood out because of their disproportionate short shanks and ulna bones. Kuchi formed an independent group owing to their comparably long body sizes. Microsatellite analysis revealed three clusters of Tanzanian chicken populations. These clusters encompassed i) Morogoro-medium and Ching'wekwe from Eastern and Central Zones ii) Unguja and Pemba from Zanzibar Islands and iii) Kuchi from Lake Zone regions, which formed an independent cluster. Sequence polymorphism of D-loop region was analysed to disclose the likely maternal origin of Tanzanian chickens. According to reference mtDNA haplotypes, the Tanzanian chickens that were sampled encompass two haplogroups of different genealogical origin. From haplotype network analysis, Tanzanian chickens probably originated on the Indian subcontinent and in Southeast Asia. The majority of Kuchi chickens clustered in a single haplogroup, which was previously found in Shamo game birds sampled from Shikoku Island of Japan in the Kōchi Prefecture. Analysis of phenotypic and molecular data, as well as the linguistic similarity of the breed names, suggests a recent introduction of the Kuchi breed to Tanzania.

show abstract

Section: Discussionmentioning

confidence: 83%

Assessing the genetic diversity of five Tanzanian chicken ecotypes using molecular tools

Lyimo¹,

Weigend²,

Janssen-Tapken³

et al. 2014

SA J. An. Sci.

View full text Add to dashboard Cite

show abstract

“…This selective sweep hypothesis is reasonable because of the harsh natural environment to which local chickens are subject in this area of the world. The geographical location of the chicken lines may elevate inbreeding frequency and isolate them from their ancestral population, which could contribute to this low genetic variation, as discussed by Peters et al (2012) and Lyimo et al (2014a). Recent reports about the European chicken population over the past 150 years suggest that these birds are directly descended from Asian chicken breeds or have been crossed with them (Lyimo et al, 2014b).…”

Section: Discussionmentioning

confidence: 99%

Genetic diversity of Hajar1 and Hajar2 local Saudi chicken lines using mitochondrial DNA D-loop markers

Ahmed¹,

Alhudaib²,

Soliman³

2016

SA J. An. Sci.

View full text Add to dashboard Cite

This study was conducted to assess genetic diversity of Hajar1 and Hajar2 local Saudi chicken lines using mitochondrial DNA (mtDNA) D-loop partial sequences. One hundred blood samples were obtained equally from Hajar1 and Hajar2 Saudi chicken lines as 50 samples from each line. The D-loop region was partially amplified from genomic DNA with a conserved primer set, and the fragments were sequenced. Eight published reference mtDNA sequence data from the GenBank were used for comparisons, and multiple alignments were performed. The most common haplotype was assigned as a basic sequence for comparing within each line. Entropy plot and conserved region analysis were performed. Genetic distances and neighbour-joining (NJ) phylogenetic trees were estimated. The results indicated haplotype variations within and between local Saudi chicken lines, which could explain the phenotypic variation reported earlier. A close genetic relationship was shown between the Saudi local chicken lines. Unique conserved regions and nucleotide substitutions were observed between the two lines. Both lines have a close relationship with the reference Asian local chicken population, especially local Chinese and Indian chicken breeds. The current results are considered the first report of mtDNA sequence diversity for Hajar1 and Hajar2 lines. Further detailed molecular genetic studies of both lines are indispensable to genetic conservation and development. ______________________________________________________________________________________

show abstract

“…For each individual, we sequenced five non‐coding regions of nuclear DNA: intron 7 from ornithine decarbo xylase (ODC1; 324 bp; OD7.F: GCTGTGTGTTT GATATGGGAGT, OD8.R: TGAAGCCAAGTTCAG CCTAA; Peters et al 2008), intron 8 from α‐enolase (ENO1; 280 bp; ENO.F: CGCGATGGAAAGTA TGACCT, ENO.R: CCAACGCTGCCAGTAAACTT; Peters et al 2008), intron 9 from phosphenolpyruvate carboxykinase (PCK1; 324 bp; PCK1‐9.F: CAGCCAT GAGATCTGAAGCA, PCK1‐9.R: TTGAGAGCTGG CTTTCATTG; McCracken et al 2009), intron 7 from fibrinogen beta chain (FGB; 401 bp; FGBF: GTTAGCAT TATGAACTGCAAGTAATTG, FGBR: TTTCTTGAAT CTGTAGTTAACCTGATG, Peters et al 2012), and intron 11 from the N‐methyl‐D‐aspartate‐1‐glutamate receptor (GRIN1; 313 bp; GRIN1‐11.F: CTGGTGGGGCTGT CTGTG, GRIN1‐11.R: ACTTTGAASCGKCCAAATG; McCracken et al 2009). Each intron is linked to a different chromosome in the chicken Gallus gallus genome (Peters et al 2012), and therefore assumed to be independent. Each locus was amplified using PCR following McCracken et al (2009) and were cleaned using AMPure XP beads following the Agencourt protocol (Beckman Coulter).…”

Section: Methodsmentioning

confidence: 99%

Multilocus phylogeography of Australian teals (Anas spp.): a case study of the relationship between vagility and genetic structure

Dhami¹,

Joseph²,

Roshier³

et al. 2012

Journal of Avian Biology

Self Cite

View full text Add to dashboard Cite

Biogeographic barriers potentially restrict gene flow but variation in dispersal or vagility can influence the effectiveness of these barriers among different species and produce characteristic patterns of population genetic structure. The objective of this study was to investigate interspecific and intraspecific genetic structure in two closely related species that differ in several life‐history characteristics. The grey teal Anas gracilis is geographically widespread throughout Australia with a distribution that crosses several recognized biogeographic barriers. This species has high vagility as its extensive movements track broad‐scale patterns in rainfall. In contrast, the closely related chestnut teal A. castanea is endemic to the mesic southeastern and southwestern regions of Australia and is more sedentary. We hypothesized that these differences in life‐history characteristics would result in more pronounced population structuring in the chestnut teal. We sequenced five nuclear loci (nuDNA) for 49 grey teal and 23 chestnut teal and compared results to published mitochondrial DNA (mtDNA) sequences. We used analysis of molecular variance to examine population structure, and applied coalescent based approaches to estimate demographic parameters. As predicted, chestnut teal were more strongly structured at both mtDNA and nuDNA (ΦST= 0.163 and 0.054, respectively) than were grey teal (ΦST < 0.0001 for both sets of loci). Surprisingly, a greater proportion of the total genetic variation was partitioned among populations within species (ΦSC= 0.014 and 0.047 for nuDNA and mtDNA, respectively) than between the two species (ΦCT < 0.0001 for both loci). The ‘Isolation with Migration’ coalescent model suggested a late Pleistocene divergence between the taxa, but remarkably, a deeper divergence between the southeastern and southwestern populations of chestnut teal. We conclude that dispersal potential played a prominent role in the structuring of populations within these species and that divergent selection associated with ecology and life history traits likely contributed to rapid and recent speciation in this pair.

show abstract

Heterogeneity in Genetic Diversity among Non-Coding Loci Fails to Fit Neutral Coalescent Models of Population History

Cited by 28 publications

References 94 publications

Assessing the genetic diversity of five Tanzanian chicken ecotypes using molecular tools

Assessing the genetic diversity of five Tanzanian chicken ecotypes using molecular tools

Genetic diversity of Hajar1 and Hajar2 local Saudi chicken lines using mitochondrial DNA D-loop markers

Multilocus phylogeography of Australian teals (Anas spp.): a case study of the relationship between vagility and genetic structure

Contact Info

Product

Resources

About