Heterodimers of NF-κB transcription factors DIF and Relish regulate antimicrobial peptide genes in Drosophila

Abstract

The innate immune response in Drosophila involves the inducible expression of antimicrobial peptide genes mediated by the Toll and IMD signaling pathways. Dorsal and DIF act downstream of Toll, whereas Relish acts downstream of IMD to regulate target gene expression. Dorsal, DIF, and Relish are NF-κB-related transcription factors and function as obligate dimers, but it is not clear how the various dimer combinations contribute to the innate immune response. We systematically examined the dimerization tendency of these proteins through the use of transgenic assays. The results show that all combinations of homo-and heterodimers are formed, but with varying degrees of efficiency. The formation of the DIFRelish heterodimer is particularly interesting because it may mediate signaling for the seemingly independent Toll and IMD pathways. By incorporating a flexible peptide linker, we specifically tested the functions of the DIF^Relish (a^sign represents the peptide linker) linked heterodimer. Our results demonstrate that the linked heterodimer can activate target genes of both the Toll and IMD pathways. The DIF and Relish complex is detectable in whole animal extracts, suggesting that this heterodimer may function in vivo to increase the spectrum and level of antimicrobial peptide production in response to different infections.IMD | innate immunity | Toll

Dnr1 mutations cause neurodegeneration in Drosophila by activating the innate immune response in the brain

“…2C). Thus, dnr1 may also negatively regulate the Toll pathway by a mechanism that has not yet been defined or by cross-regulation between the two pathways (21). In either case, loss of dnr1 leads to increased expression of AMPs downstream of both the Imd and the Toll innate immuneresponse pathways.…”

Retromer Promotes Immune Quiescence by Suppressing Spätzle‐Toll Pathway in Drosophila

“…As a ligand, active Spz binds and activates the transmembrane receptor Toll (Hu et al, 2004; Weber et al, 2003). The activation of Toll initiates an intracellular signal transduction pathway, which leads to the translocation of Dorsal and Dorsal-related immunity factor (DIF) into the nucleus for the transcriptional activation of downstream targets, including antimicrobial peptide genes (Belvin et al, 1995; Ip et al, 1993; Lemaitre et al, 1996; Meng et al, 1999; Rutschmann et al, 2000; Tanji et al, 2010). Upon infection, the Toll pathway amplifies the signal through enzyme cascades as well as through positive feedback loops (Jang et al, 2006; Lemaitre and Hoffmann, 2007; Lemaitre et al, 1996).…”

Charon Mediates Immune Deficiency–Driven PARP-1–Dependent Immune Responses in Drosophila

“…Full-length Relish undergoes endoproteolytic cleavage by the caspase-8 Dredd to generate two isoforms (Rel68 and Rel49) (14, 15). Once Rel68 translocates into the nucleus, it serves as a transcription activator by binding to promoters of many antimicrobial genes, such as Drosomycin (36, 41). In addition, phosphorylation of Rel68 at Ser-528 and -529 by the IKK complex comprised of IRD5, a catalytic kinase subunit, and Kenny, a regulatory subunit, is also critical for Rel68 transcription activation (42).…”

“…To detect Drosomycin or Diptericin DNA in ChIP experiments, we used 2 pairs of primers, as shown below, distributed along the promoter regions of Drosomycin and Diptericin genes, which have been demonstrated to bear NF-KB binding sites (36; 37). The primer sequences were as follows: 5′ TTTCGCTTACGCTTTTCGAT′ (forward) and 5′ ATAGTGCACCGATCCCTCAG 3′ (reverse) for Drosomycin promoter; 5′ GATCCCCTGGTGGTATTTG 3′ (forward) and 5′ CTTTCCAAAAGGAATCCCCG 3′ (reverse) for Diptericin promoter.…”

“…Xl – Xenopus laevis; Af - Aspergillus fumigatus; Lc - Lucilia cuprina; Hc - Haemonchus contortus; Dm - Drosophila melanogaster; Rr - Rhinopithecus roxellana; Md - Musca domestica; Lk - Leptospira kirschneri; Cc - Ceratitis capitata; Bc - Bactrocera cucurbitae; Ob - Octopus bimaculoides; Ov - Opisthorchis viverrini . C. Charon protein interacts with components of IMD pathway [36,41]. D. The expression of Charon-GFP transgenic reporter and siRNA transgenes against Charon .…”