Hepatocyte Growth Factor Activator Inhibitor Type 1 Maintains the Assembly of Keratin into Desmosomes in Keratinocytes by Regulating Protease-Activated Receptor 2–Dependent p38 Signaling

Abstract

Hepatocyte growth factor activator inhibitor type 1 (HAI-1; official symbol SPINT1) is a membraneassociated serine proteinase inhibitor abundantly expressed in epithelial tissues. Genetically engineered mouse models demonstrated that HAI-1 is critical for epidermal function, possibly through direct and indirect regulation of cell surface proteases, such as matriptase and prostasin. To obtain a better understanding of the role of HAI-1 in maintaining epidermal integrity, we performed ultrastructural analysis of Spint1-deleted mouse epidermis and organotypic culture of an HAI-1 knockdown (KD) human keratinocyte cell line, HaCaT. We found that the aggregation of tonofilaments to desmosomes was significantly reduced in HAI-1edeficient mouse epidermis with decreased desmosome number. Similar findings were observed in HAI-1 KD HaCaT organotypic cultures. Immunoblot and immunohistochemical analyses revealed that p38 mitogen-activated protein kinase was activated in response to HAI-1 insufficiency. Treatment of HAI-1 KD HaCaT cells with a p38 inhibitor abrogated the above-observed ultrastructural abnormalities. The activation of p38 induced by the loss of HAI-1 likely resulted from enhanced signaling of protease-activated receptor-2 (PAR-2), because its silencing abrogated the enhanced activation of p38. Consequently, treatment of HAI-1 KD HaCaT cells with a serine protease inhibitor, aprotinin, or PAR-2 antagonist alleviated the abnormal ultrastructural phenotype in organotypic culture. These results suggest that HAI-1 may have a critical role in maintaining normal keratinocyte morphology through regulation of PAR-2edependent p38 mitogen-activated protein kinase signaling. Human skin protects the body from both water loss and mechanical damage. This barrier function is primarily accomplished by the epidermis, a self-renewing stratified squamous epithelium composed of several layers of keratinocytes. 1 To achieve the barrier functions, keratinocytes form dynamic and strong cell-cell junctions in which desmosomes and the network of keratin intermediate filaments (KIFs) are essential to maintain junctional integrity. 2 KIFs are anchored to the cytoplasm and interact with desmosomal cell-cell contacts at the plasma membrane. These are important for mechanical stability of cell-cell contacts between keratinocytes. 3 Disturbance of the integrity of the KIF network leads to skin-blistering diseases, such as epidermolysis bullosa simplex. 4 Although it is not known how KIF disassembly is regulated, recent studies suggested that p38 mitogen-activated protein kinase (MAPK) signaling is involved in these processes. 4e6 The p38 is a member of the MAPK family. It is present in epithelial cells, responds rapidly to various types of stresses,

Hepatocyte growth factor activator inhibitors (HAI‐1 and HAI‐2): Emerging key players in epithelial integrity and cancer

“…However, the Spint1 −/− neonates died within 16 days of birth, showing abnormal epidermal keratinization, cuticle defect in hair and whiskers, decreased barrier function of the skin and dermal inflammation (Fig. b) . The disturbance of epidermal integrity by Hai‐1/Spint1 deficiency was also reported in a zebrafish mutant model .…”

Deregulated matriptase activity in oral squamous cell carcinoma promotes the infiltration of cancer‐associated fibroblasts by paracrine activation of protease‐activated receptor 2

“…The activity was expressed either by relative fluorescence unit (RFU) at each time point or the calculated maximum slope of the hydrolysis rate (velocity max: V max ). For transient silencing of matriptase, two kinds of small interfering RNA (siRNA) were used as described previously . One (mat siRNA #1) was Stealth™ siRNA (Invitrogen) and the sequence was 5′‐GCGUGUACACAAGGCUCCCUCUGUU‐3′.…”

“…Therefore, we hypothesized that the loss of HAI‐1 might have a causal role in the recruitment of CAFs. Some evidence suggests that insufficient HAI‐1 activity enhances pericellular serine protease activities, particularly of matriptase . Matriptase is one of the most studied TTSPs and has important roles in carcinogenesis and cancer progression .…”

“…PAR‐2 is a seven transmembrane spanning domain G protein‐coupled receptor that is activated by trypsin, coagulation factor VII/tissue factor complex, coagulation factor Xa and tryptase . Recent evidence indicates that matriptase is also an important activator of PAR‐2 . The proteolytic activation of PAR‐2 induces various cellular responses, including migratory activity .…”

Desmosomes and Intermediate Filaments: Their Consequences for Tissue Mechanics

“…Further studies suggest that the type II keratin KRT5 is a major determinant of desmosome stability (Loschke et al 2016). In addition to PKCa, p38 MAP kinase (MAPK) signaling downstream from the serine protease inhibitor SPINT1 participates in the interaction of keratins and desmosomal proteins (Kawaguchi et al 2015).…”