Hepatitis G virus (HGV), its prevalence and genotypes in patients with hepatitis B &amp; C in Ahvaz, Southwest Iran

Javanmard, Davod; Makvandi, Manoochehr; Hajiani, Eskandar; Khalafkhany, Davod

doi:10.3906/sag-1203-55

Cited by 2 publications

(2 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The specific female prevalence of HGV was 0% among both patients and healthy control females, while male prevalence was 3.5 %. Current study result was different to the sex distribution of HGV /GBV-C infection in western countries where equal distribution is the feature in all reports 22,23 . In addition; the present study showed that there was trend toward increased levels of HGV/GBV-C infection with the second, and the third decades of life where the rates were 3.5% , with OR=1.4, and 7.1% with OR=2.95 respectively.…”

Section: Resultscontrasting

confidence: 91%

Prevalence of Hepatitis G Virus Among Patients With Chronic Liver Disease and Healthy Individuals, Sana'a City-Yemen

et al. 2019

View full text Add to dashboard Cite

Hepatitis G virus (HGV) is a newly discovered and enveloped RNA positive-stranded flavivirus-like particle, which has not yet been proven to have major negative effects on liver. Therefore, it is important to estimate the prevalence and risk factors of hepatitis G virus infection in Yemeni viral hepatitis patients and general population to design standard prevention and treatment plans. Screening HGV antibodies among 60 chronic HBV and 144 chronic HCV patients comparing with it's prevalence in 218 healthy controls were carried out. Serum samples were collected and tested for human HGV IgG by commercially available ELISA technique. Demographic data such as gender, age, and risk factors of contracting HGV virus were recorded in predesigned questionnaire. The crude prevalence rate of HGV was 2.8%, female specific rate was 0% and male specific rate was 3.5%. The prevalence of HGV among HBV patients was 0%; HCV was 1.4% while in healthy individuals it was 4.6%. When age groups considered, the prevalence of HGV among age groups 20-29 years and 30-39 years was 3.5%, while in older age groups the rate of HGV was 0%. There was a trend towards increased levels of HGV infection with the second and third decades of life (3.5%). There was no significant association between HGV infection and risk factors of hepatitis viruses. It can be concluded from this study that HGV virus is circulating in the risk groups and in the community in general Yemen, and there is a possibility that this virus may at some time become epidemic if preventive measures are not applied. The risk of community among healthy people more than in risk groups as HBV and HCV patients. Additionally HGV increases with young male adults.

show abstract

Section: Resultscontrasting

confidence: 91%

Prevalence of Hepatitis G Virus Among Patients With Chronic Liver Disease and Healthy Individuals, Sana'a City-Yemen

et al. 2019

View full text Add to dashboard Cite

show abstract

“…The nested PCR was carried out using 4 primers conserved in the 5' un-translated region of genomic HGV (21). The reaction mixture contained 2.5 µL of PCR buffer (Roche), 0.3 mmol of dNTP, 0.125 µL of enzyme (taq DNA polymerase 5 unit, Roche), 1.5 mmol of MgCl 2 , and 1.5 pmol/µL of primers (nucleotides 102 to 121 as Fhg1 contained GCCAAAAGGTGGTGGATGGG as the forward primer, and nucleotides 457 to 477 as Rhg1 contained CG-GAGCTGGGTGGCCCCATGC as the reverse primer) and water up to 25 µL.…”

Section: Nested Polymerase Chain Reactionmentioning

confidence: 99%

Prevalence of Hepatitis G Virus and Co-Infection with Hepatitis B Virus and Hepatitis C Virus Among Hemodialysis Patients in Ahvaz, Iran

Sanchooli

Makvandi

Nisi

et al. 2018

Jundishapur J Chronic Dis Care

View full text Add to dashboard Cite

Background: Patients on hemodialysis are at a high-risk for acquiring blood-borne infections, such as hepatitis G, hepatitis C, and hepatitis B viruses. The aim of this investigation was to determine the prevalence of HGV infection among patients on hemodialysis and its co-infection with hepatitis C and B viruses in Ahvaz. Methods: Blood samples were collected from patients on hemodialysis during January to July, 2016. RNAs were extracted from sera and cDNA was prepared using the kit. The nested-polymerase chain reaction (PCR) and sequencing of positive samples were carried out to determine hepatitis G virus genotypes. In addition, to evaluate the co-infection of HGV with hepatitis C and hepatitis B virus infections, the sera of all the individuals were tested for hepatitis C virus antibody and HBs-Ag by enzyme linked immunosorbent assay (ELISA) assay. Results: The HGV RNA was found in 10% of the patients with dominant genotype 2a. About 2% of the patients on hemodialysis were co-infected with hepatitis C virus while 1% of them was co-infected with hepatitis B virus. The statistical analysis revealed that there was a significant correlation (P < 0.01) between duration of the hemodialysis process and hepatitis G virus infectivity. Conclusions: The present study showed that patients, who used the hemodialysis devices in this city, were infected with Hepatitis G, hepatitis B, and hepatitis C viruses. The data indicates that duration of dialysis is significantly related to infection of Hepatitis G virus. Therefore, it is critical to control the sterility of these equipment for intercepting cross-infectivity.

show abstract

Hepatitis G virus (HGV), its prevalence and genotypes in patients with hepatitis B & C in Ahvaz, Southwest Iran

Cited by 2 publications

References 27 publications

Prevalence of Hepatitis G Virus Among Patients With Chronic Liver Disease and Healthy Individuals, Sana'a City-Yemen

Prevalence of Hepatitis G Virus Among Patients With Chronic Liver Disease and Healthy Individuals, Sana'a City-Yemen

Prevalence of Hepatitis G Virus and Co-Infection with Hepatitis B Virus and Hepatitis C Virus Among Hemodialysis Patients in Ahvaz, Iran

Contact Info

Product

Resources

About