Hepatitis C Virus Is Released via a Noncanonical Secretory Route

Abstract

We analyzed hepatitis C virus (HCV) morphogenesis using viral genomes encoding a mCherry-tagged E1 glycoprotein. HCV-E1-mCherry polyprotein expression, intracellular localization, and replication kinetics were comparable to those of untagged HCV, and E1-mCherry-tagged viral particles were assembled and released into cell culture supernatants. Expression and localization of structural E1 and nonstructural NS5A followed a temporospatial pattern with a succinct decrease in the number of replication complexes and the appearance of E1-mCherry punctae. Interaction of the structural proteins E1, Core, and E2 increased at E1-mCherry punctae in a time-dependent manner, indicating that E1-mCherry punctae represent assembled or assembling virions. E1-mCherry did not colocalize with Golgi markers. Furthermore, the bulk of viral glycoproteins within released particles revealed an EndoH-sensitive glycosylation pattern, indicating an absence of viral glycoprotein processing by the Golgi apparatus. In contrast, HCV-E1-mCherry trafficked with Rab9-positive compartments and inhibition of endosomes specifically suppressed HCV release. Our data suggest that assembled HCV particles are released via a noncanonical secretory route involving the endosomal compartment. IMPORTANCEThe goal of this study was to shed light on the poorly understood trafficking and release routes of hepatitis C virus (HCV). For this, we generated novel HCV genomes which resulted in the production of fluorescently labeled viral particles. We used live-cell microscopy and other imaging techniques to follow up on the temporal dynamics of virus particle formation and trafficking in HCV-expressing liver cells. While viral particles and viral structural protein were found in endosomal compartments, no overlap of Golgi structures could be observed. Furthermore, biochemical and inhibitor-based experiments support a HCV release route which is distinguishable from canonical Golgi-mediated secretion. Since viruses hijack cellular pathways to generate viral progeny, our results point toward the possible existence of a not-yet-described cellular secretion route. Hepatitis C virus (HCV) belongs to the Flavivirus genus and has a positive-strand RNA genome. This encodes a polyprotein which is posttranslationally cleaved into six nonstructural (NS) proteins, the ion channel p7 protein, and the structural proteins Core, E1, and E2 (1). The NS proteins reside at the outer leaflet of the endoplasmic reticulum (ER) membrane where NS4B and NS5A in particular induce membrane alterations resulting in the formation of the membranous web, which is the major site for HCV replication (2-5). Core is targeted to adjacent lipid droplets (LDs) (6, 7), which represent intracellular lipid deposits and are considered important for production of infectious particles (1,7,8). The E1 and E2 envelope proteins are incorporated into ER membranes with ectodomains facing the ER lumen (9, 10). Later, they are recruited to assembly sites via the NS2 complex (11,12). Upon recruitment of all requi...

The Intracellular Cholesterol Transport Inhibitor U18666A Inhibits the Exosome-Dependent Release of Mature Hepatitis C Virus

“…To further corroborate these data, Huh7.5 cells were transfected with the J6-E1-mCherry construct that harbors an mCherry sequence inside the variable region of E1 and thus enables the production of mCherry-labeled viral particles. The functionality of this type of fusion protein and the capacity to form viral particles have been established by Bayer et al (68) and confirmed for the construct/experimental system used in this study (see Fig. S3C to G at the URL mentioned above).…”

“…pFK-Luc-J6 was kindly provided by R. Bartenschlager and has been described previously (44). The J6-E1-mCherry (E1R) construct was generated in a manner similar to that described by Bayer et al (68). The mCherry sequence was amplified with the primers fwd (AAACGTACGC GATGGTGAGCAA) and rev (AAACGTACGCCTTGTACAGCTCGT) with the plasmid pmCherry (Clontech) as a template.…”

Differential Regulation of Lipoprotein and Hepatitis C Virus Secretion by Rab1b

“…Assembled HCV particles exit the cell as cargoes of the vesicular secretory pathway. The Golgi, Rab11a-positive recycling endosomes, and Rab5a/7a/9a-positive endosomes have each been implicated in HCV secretion (Gastaminza et al, 2008, Coller et al, 2012, Wozniak et al, 2016, Lai et al, 2010, Bayer et al, 2016). Secretion of infectious HCV particles requires that the infected cell express apolipoproteins, such as ApoE and ApoB100 (Fukuhara et al, 2014, Hueging et al, 2014), which are associated with the released infectious HCV particles (Catanese et al, 2013).…”

Hepatitis C Virus Lipoviroparticles Assemble in the Endoplasmic Reticulum (ER) and Bud off from the ER to the Golgi Compartment in COPII Vesicles

“…Dominant negative mutants of Rab GTPases involved in TGN-endosome trafficking inhibited HCV release but did not have a concomitant effect on the secretion of ApoB or ApoE (28). While some studies favor HCV egress through the Golgi route (31)(32)(33), others suggest a noncanonical secretory pathway (34). Intriguingly, the endocytic and endosomal sorting complex required for transport (ESCRT) machineries have also been implicated in HCV secretion (35,36).…”

“…Intriguingly, the endocytic and endosomal sorting complex required for transport (ESCRT) machineries have also been implicated in HCV secretion (35,36). The intracellular cholesterol transport inhibitor U18666A promotes the accumulation of HCV particles in autophagosomal and exosomal structures, reflecting the involvement of exosomes in HCV secretion (34,37).…”