Hepatitis B virus X protein modulates oncogene yes-associated protein by CREB to promote growth of hepatoma cells

Abstract

Hepatitis B virus X protein (HBx) plays critical roles in the development of hepatocellular carcinogenesis (HCC). Yes-associated protein (YAP), a downstream effector of the Hipposignaling pathway, is an important human oncogene. In the present article, we report that YAP is involved in the hepatocarcinogenesis mediated by HBx. We demonstrated that the expression of YAP was dramatically elevated in clinical HCC samples, hepatitis B virus (HBV)-infected hepatoma HepG2.2.15 cell line, and liver cancer tissues of HBx-transgenic mice. Meanwhile, we found that overexpression of HBx resulted in the up-regulation of YAP in stably HBx-transfected HepG2/H7402 hepatoma cell lines, whereas HBx RNA interference reduced YAP expression in a dose-dependent manner in the above-mentioned cell lines, suggesting that HBx up-regulates YAP. Then, we investigated the mechanism underlying the up-regulation of YAP by HBx. Luciferase reporter gene assays revealed that the promoter region of YAP regulated by HBx was located at nt 2232/1115 containing cyclic adenosine monophosphate response element-binding protein (CREB) element. Chromatin immunoprecipitation (ChIP) demonstrated that HBx was able to bind to the promoter of YAP, whereas it failed to work when CREB was silenced. Moreover, we confirmed that HBx activated the YAP promoter through CREB by electrophoretic mobility shift assay and luciferase reporter gene assays. Surprisingly, we found that YAP short interfering RNA was able to remarkably block the HBx-enhanced growth of hepatoma cells in vivo and in vitro. Conclusion: YAP is a key driver gene in HBx-induced hepatocarcinogenesis in a CREB-dependent manner. YAP may serve as a novel target in HBV-associated HCC therapy. (HEPATOLOGY 2012;56:2051-2059 H epatocellular carcinoma (HCC) is the fifthmost common cancer and the third leading cause of cancer death worldwide. 1 Hepatitis B virus (HBV) infection is one of the major causes of HCC. 2 Among the four proteins encoded by HBV, the HBV X protein (HBx) is a multifunctional regulatory protein and plays a crucial role in hepatocellular carcinogenesis. 3 Although it does not bind directly to DNA, HBx modulates transcriptional activation by interacting with nuclear transcription factors, such as activating protein 1 (AP-1), nuclear factor kappa lightchain enhancer of activated B cells (NF-jB), specificity protein 1 (Sp-1), and cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB), and affects the cytoplasmic modulation of signal transduction pathways. 4,5

MiR-506 suppresses proliferation of hepatoma cells through targeting YAP mRNA 3′UTR

“…Human hepatoma cell lines, HepG2 and H7402 [20] , were maintained in Dulbecco's modified Eagle's medium and RPMI medium 1640, respectively (Gibco, CA, USA). Media were supplemented with heat inactivated 10% fetal bovine serum (FBS, Gibco, CA, USA), 100 U/mL penicillin and 100 mg/mL streptomycin in 5% CO 2 at 37 °C.…”

“…More importantly, liver-specific overexpression of YAP results in a greater than 5-fold size enlargement that is reversible after cessation of YAP expression [16,19] . Previously, our group found that the expression levels of YAP were [20] . However, understanding of the post-transcriptional control of the YAP gene in liver cancer remains elusive.…”

MEK1 promotes YAP and their interaction is critical for tumorigenesis in liver cancer

“…Cells were treated by PD98059 (15-50 lM, Cell Signaling Technology (CST), Boston, MA, USA) or U0126 (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20) lM, CST) 24 h before harvest. ShRNAs were cloned into pLKO.1 lentiviral vectors using primers as follows: MEK1-sh#1-Forward: CCGGAACTCTGGATCAAGTCCTGAACTCGAGTTCAGGACTTGATCCA-GAGTTTTTTTG and Reward: AATTCAAAAAAACTCTGGATCAAGTC C TGAACTCGAGTTCAGGACTTGATCCAGAGTT; MEK1-sh#2-Forward: CCGGAAGGACTCATTACTCTGTGCACTCGAGTGCACAGAGTAATGAGT CCTTTTTTTG and Reward: AATTCAAAAAAAGGACTCATTACTCTG TGCACTCGAGTGCACAGAGTAATGAGTCCTT.…”

Regulation of ERK and AKT Pathways by Hepatitis B Virus X Protein via Notch1 Pathway in Hepatocellular Carcinoma

“…Real-time PCR primers are listed in Table II Transient RNA interference. Small interfering RNA (siRNA) duplexes targeting human HBx, Hes1, DUSP1, and PTEN sequences and a scrambled siRNA were designed as described previously (5,(21)(22)(23). All siRNAs were synthesized by Ribobio (Guangzhou, China).…”

“…HBV X protein (HBx) is the only expressed HBV protein and plays critical roles in hepatocarcinogenesis (4). Previous reports have shown that HBx interferes with many signal transduction pathways including Hippo, nuclear factor-κB, WNT/β-catenin, and p53 pathways (2,(4)(5)(6)(7). However, the molecular mechanisms underlying the hepatocellular carcinogenesis induced by HBx remain unclear.…”