Hepatitis B Virus Genomes of Patients With Fulminant Hepatitis Do Not Share A Specific Mutation

Abstract

The pathogenesis of fulminant hepatitis B virus (HBV) infection is not well understood. The aim of this study was to investigate whether there is an association between specific viral variants and a fulminant disease course. The entire HBV genomes from the serum of eight patients with fulminant HBV infection and one patient with fulminant hepatitis during reinfection after liver transplantation were investigated. After isolation and amplification of viral DNA by polymerase chain reaction (PCR), plus and minus strands were directly sequenced. Sequence data were analyzed by comparative sequence alignments with 35 and 2 complete HBV genome sequences from patients without and with fulminant hepatitis, respectively. Several point mutations were present in all regions of the genomes. Many nucleotide changes had never or rarely been found in the reported HBV isolates from patients without fulminant hepatitis. A distinct mutation present in all genomes was not identified. Clusters of rare and unique mutations were observed in the enhancer II core promoter region. Mutations previously suggested to be associated with fulminant HBV infection were not consistently found. A precore stop codon mutation at nucleotide position 1896 or an A-to-T mutation at nucleotide position 1762 and a G-to-A mutation at nucleotide position 1764 in the core promoter region were present in four and three cases, respectively. Fulminant HBV infection does not appear to be caused by a specific genomic mutation. However, various mutations clustering in the enhancer II core promoter region may contribute to a fulminant disease course.

Transmission of a homogenous hepatitis B virus population of A1896-containing strains leading to mild resolving acute hepatitis and seroconversion to hepatitis B e antigen antibodies in an adult

“…[18][19][20] ence), with antisense primer Cb 5GCTTGCCTGAGTGCTGTATG Finally, it is well known that hepatitis B core antigen (positions 2054 to 2074). A sense primer C3 was also used to (HBcAg) and HBeAg share B-cell epitopes and that HBeAg confirm the sequence.…”

Hepatitis B Virus Mutants and Fulminant Hepatitis B: Fitness Plus Phenotype

“…Thus, the unique genetic framework of the predominant HBV quasispecies with multiple mutations within a gene or genes associated with FHB have been studied. 8,20,25,33 These more recent studies, including the report by Kalinina et al, suggest that multiple mutations throughout the genome may contribute to (1) an increase in viral replication fitness, (2) a change in viral gene expression, or (3) an alteration of cytotoxic T lymphocyte epitopes. These virologic markers either alone or in various combinations and the interplay between the virus and the host are clearly important in the development of FHB.…”

High Prevalence of 1762T 1764A Mutations in the Basic Core Promoter of Hepatitis B Virus Isolated From Black Africans With Hepatocellular Carcinoma Compared With Asymptomatic Carriers

“…The BCP, mapping between nucleotides 1742 and 1849, controls the transcription of both precore messenger RNA (mRNA), which codes for the protein that is the precursor of the e antigen, and pregenomic RNA (pgRNA), which controls HBV replication. 11 A pair of mutations in the BCP that is associated with a reduced level of HBeAg expression was first described in Japanese patients [12][13][14] : an adenine (A) to thymine (T) transversion at position 1762 together with a guanine (G) to A transition at 1764 in the second AT-rich region of the BCP are often present in patients with chronic hepatitis B [15][16][17][18][19][20] and fulminant hepatitis B, [14][15][16][21][22][23] and less often in asymptomatic carriers (ASCs), 17 immunosuppressed patients, 24 and carriers without serological HBV markers. 25,26 These two mutations have also been reported in HBV DNA from sera 17 and tumor and liver tissue from patients with HBV-related hepatocellular carcinoma (HCC), 27 although the significance of this finding is yet to be determined.…”