Hepatitis B Viral DNA Decline at Loss of HBeAg Is Mainly Explained by Reduced cccDNA Load – Down-Regulated Transcription of PgRNA Has Limited Impact

Abstract

Background Quantification of hepatitis B virus (HBV) DNA and surface antigen (HBsAg) serum levels have become increasingly important for the assessment of clinical stage and response to treatment for chronic hepatitis B. Effective immune clearance results in reduction of viremia by 4–5 log units and HBsAg levels by 2 log, but these processes are not well understood. Thus, it is uncertain to what extent mechanisms that inhibit transcription of the pregenomic RNA (pgRNA), an RNA intermediate, contribute to suppression of viremia. Likewise, it is unclear if transcriptional regulation is important for the excessive production of surface antigen (HBsAg) that is a hallmark of HBV infection. Methods HBV RNA and cccDNA were quantified in 19 liver biopsies from patients with chronic HBV infection, as well as in transfected Huh7.5 cells and in PLC/PRF/5 cells carrying integrated HBV genome. Results Patients negative for HBeAg had 2.15 log lower levels of cccDNA in liver tissue, 4.84 log lower serum levels of HBV DNA and 1.45 log lower serum levels of HBsAg, than HBeAg-positive patients. The pgRNA in liver tissue correlated strongly with cccDNA (R 2 = 0.87, p<0.0001) and HBV DNA levels in serum (R 2 = 0.81, p<0.0001), whereas S-RNA correlated strongly with cccDNA (R 2 = 0.65, p<0.0001) and HBsAg levels (R 2 = 0.57, p = 0.0003). The S-RNA/pgRNA ratio was higher in HBeAg-negative patients (ratio 40 vs. 3, p = 0.01) and in PLC/PRF/5 cells, and was in transfected Huh7.5 cells not influenced by mutations in the HBV core promoter. Conclusion The reduction of viremia that is observed after loss of HBeAg was mainly explained by reduced cccDNA load in the liver, whereas the contribution of down-regulation of pgRNA transcription was relatively small. Enhanced transcription of S-RNA does not explain excessive production of HBsAg.

Definition of an HBsAg to DNA international unit conversion factor by enrichment of circulating hepatitis B virus forms

“…Our approach could be useful to study the influence of particular mutations occurring in the HBV genome or the subtle regulation of HBs mRNA transcription during CHB as proposed by Malmström et al . . Interestingly, fractionation of supernatant and measurement of HBsAg and HBV DNA in each fraction also confirmed our findings obtained using patient plasma regarding the relative sensitivity of the respective detection techniques.…”

Suppression of hepatitis B virus DNA accumulation in chronically infected cells using a bacterial CRISPR/Cas RNA-guided DNA endonuclease

“…For HBV cccDNA amplification, we used TaqMan primers previously shown (Chen et al, 2004) to specifically amplify cccDNA using an AB7900 HT sequence detection system (Applied Biosystems) or the Light Cycler 480 instrument (Roche). Closely similar data (not shown) were also obtained using a second set of previously described, HBV cccDNA-specific primers (Malmstrom et al, 2012)…”

Acute hepatitis B virus infection in humanized chimeric mice has multiphasic viral kinetics

“…The following primers were used: total HBV (forward primer: 5′‐CACATCAGGATTCCTAGGACC‐3′, reverse primer: 5′‐AGGTTGGTGAGTGATTGGAG‐3′, TaqMan probe: 5′‐CAGAGTCTAGACTCGTGGTGGACTTC‐3′), cccDNA (forward primer: 5′‐CTCCCCGTCTGTGCCTTCT‐3′, reverse primer: 5′‐GCCCCAAAGCCACCCAAG‐3′, TaqMan prove: 5′‐CGTCGCATGGARACCACCGTGAACGCC‐3′). Phenol chloroform isolated HBV DNA was quantified by qPCR amplification of 30 ng of liver DNA using an Applied Biosystems 7300 real‐time thermocycler (Applied Biosystems) for total HBV, cccDNA, and human telomerase reverse transcriptase (hTERT; forward primer: 5′‐ AAAATAGCTGGAACTGCAGACA‐3′, reverse primer: 5′‐ AAGCAAAGCTACAGAAACACTCA ‐3′). HBV‐DNA levels were determined relative to standard curve comprised of serial dilutions of a plasmid containing the HBV genome.…”