Hepatitis B core protein promotes liver cancer metastasis through miR-382-5p/DLC-1 axis

Abstract

The hepatitis B virus core protein (HBc), also named core antigen, is well-known for its key role in viral capsid formation and virus replication. Recently, studies showed that HBc has the potential to control cell biology activity by regulating host gene expression. Here, we utilized miRNA microarray to identify 24 upregulated miRNAs and 21 downregulated miRNAs in HBc-expressed HCC cells, which were involved in multiple biological processes, including cell motility. Consistently, the in vitro transwell assay and the in vivo tail-vein injection model showed HBc promotion on HCC metastasis. Further, the miRNA-target gene network analysis displayed that the deleted in liver cancer (DLC-1) gene, an important negative regulator for cell motility, was potentially targeted by several differentially expressed miRNAs in HBc-introduced cells. Introduction of miRNAs mimics or inhibitors and 3'UTR luciferase activity assay proved that miR-382-5p efficiently suppressed DLC-1 expression and its 3'-UTR luciferase reporter activity. Importantly, cotransfection of miR-382-5p mimics/inhibitors and the DLC-1 expression vector almost abrogated HBc promotion on cell motility, indicating that the miR-382-5p/DLC-1 axis is important for mediating HBc-enhanced HCC motility. Clinical HCC samples also showed a negative correlation between miR-382-5p and DLC-1 expression level. Furthermore, HBc-positive HCC tissues showed high miR-382-5p level and reduced DLC-1 expression. In conclusion, our findings revealed that HBc promoted HCC motility by regulating the miR-382-5p/DLC-1 axis, which might provide a novel target for clinical diagnosis and treatment.

Colorectal cancer-derived exosomal miR-106b-3p promotes metastasis by down-regulating DLC-1 expression

“…Moreover, there is compelling evidence that DLC-1 inhibits tumour metastasis. Du et al demonstrated that miR-382-5p/DLC-1 regulated the migration and invasion of liver cancer [33]. Therefore, we investigated whether DLC-1 regulates colorectal cancer metastasis.…”

A tumor suppressor DLC1: The functions and signal pathways

“…Both in vitro and in vivo experiments show the hepatitis B virus core protein promotes HCC cell migration and metastasis by upregulating miR‐382‐5p, which in turn leads to downregulation of DLC1, and this is further validated in clinical HCC samples (Du et al, ).…”

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

“…The mature gene locus were chr14:101,054,316-101,054,337, and the base sequence was GAAGUUGUUCGUGGUGGAUUCG , with a length of 22 nt. (Fig.1) 2.1.2 hsa-miR-382-5P participates in disease regulation Using PubMed to retrieve the related literature of miR-382-5P, we found that miR-382-5P was upregulated in acute promyelocytic leukemia [7,8] , atherosclerosis [12] ,breast cancer [4] ,epidural fibrosis [10] , primary myelofibrosis [9] , primary liver cancer [11] ,cervical cancer [13] , but down-regulated in glioma [5,6] ,oral squamous cell carcinoma [3] ,miR-382 was down-regulated in non-small cell lung cancer [14,15] , osteosarcoma [16] , prostate cancer [19] ,ovarian cancer [20] , primary liver cancer [24] , colorectal cancer [21,22] , while schizophrenia [25] ,diabetic nephropathy [17] , IgA nephropathy [18] ,infantile hemangioma [23] . Thus, the expression of miR-382-5P is tissue-specific, and it is involved in the regulation of cell viability, migration, invasion, angiogenesis, proliferation, cell differentiation, oxidative stress and other biological behaviors.…”

“…A series of nucleases obtained mature miR-382-5P and miR-382-3P by cutting and editing miR-382, in which miR-382-5P was located in the long arm of chromosome 14. In recent years, many studies have shown that the expression of miR-382-5P is abnormal in oral squamous cell carcinoma [3] ,breast cancer [4] ,glioma [5,6] ,acute promyelocytic leukemia [7,8] ,primary myelofibrosis [9] ,epidural fibrosis [10] ,primary liver cancer [11] ,atherosclerosis [12] ,cervical cancer [13] ,miR-382 is abnormal in non-small cell lung cancer [14,15] , osteosarcoma [16] , diabetic nephropathy [17] , IgA nephropathy [18] prostate cancer [19] ,ovarian cacner [20] ,colorectal cancer [21,22] ,infantile hemangioma [23] ,primary liver cancer [24] ,schizophrenia [25] , which are closely related to the proliferation, differentiation, migration, invasion, drug resistance and other biological processes of tumor cells. However, the expression and clinical significance of miR-382-5P in ovarian cancer have not been reported.…”