Hepatitis A-virus particles in stools of patients from a natural hepatitis outbreak in Germany

Flehmig, Bertram; Hensel, Frank; Frösner, Gert; Gerth, H. J.

doi:10.1007/bf02126679

Cited by 26 publications

(7 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…As the indication for an apoptotic reaction after infection with HAV cyt/HB1.1 correlates with a TCID 50 titer of above 10 7 /10 6 cells (data not shown), it is also possible that at this time HAV/7 directly (4) 142 (12) 83 1.5 ϫ 10 7 (0.3) HAV cyt/HB1.1 (10) 68 (9) 92 ND a Mock-and HAV-infected cells were transfected with 20 g of poly(IC)/ml by DEAE-dextran 24 h p.i. and 16 h after induction, CAT expression was analyzed, and the TCID 50 titer was determined.…”

Section: Hav Infection Does Not Induce Ifn-␤ Synthesismentioning

confidence: 87%

Hepatitis A Virus Inhibits Cellular Antiviral Defense Mechanisms Induced by Double-Stranded RNA

Brack

Berk

Magulski

et al. 2002

J Virol

View full text Add to dashboard Cite

The consequences of a hepatitis A virus (HAV) infection on cell-based antiviral responses and the interactions between virus and host cells resulting in persistent infections are poorly understood. In this report, we show that HAV does inhibit double-stranded (dsRNA)-induced beta interferon (IFN-␤) gene expression by influencing the IFN-␤ enhanceosome, as well as dsRNA-induced apoptosis, which suggests that both effects may be connected by shared viral and/or cellular factors. This ability of HAV, which preserves the sites of virus production for a longer time, may allow the virus to establish an infection and may be the presupposition for setting up persistent infections. Our results suggest that the inhibitory effect of HAV on the cellular defense mechanisms might not be sufficient to completely prevent the antiviral reactions, which may be induced by accumulating viral dsRNA, at a later stage of infection. However, HAV seems to counteract this situation by downregulation of viral replication and in the following production of viral dsRNA. This ability of noncytopathogenic HAV acts dominantly on cytopathogenic HAV in trans. The downregulation might ensure the moderate replication which seems necessary for inhibition of the antiviral mechanisms by HAV and therefore for the persistent state of the HAV infection.

show abstract

Section: Hav Infection Does Not Induce Ifn-␤ Synthesismentioning

confidence: 87%

Hepatitis A Virus Inhibits Cellular Antiviral Defense Mechanisms Induced by Double-Stranded RNA

Brack

Berk

Magulski

et al. 2002

J Virol

View full text Add to dashboard Cite

show abstract

“…The pediatric HAV vaccine is currently available in approximately 80 countries. The vaccine is presented as a sterile suspension for intramuscular use in pre-filled, 0.5 mL syringes or 5 mL multidose vials containing purified, formaldehydeinactivated HAV obtained from the GBM strain cultured on Medical Research Council cell strain 5 (MRC-5) human diploid cells [29]. Each dose of the vaccine contains 80 antigen units of the active substance, aluminum hydroxide (expressed as aluminum) adjuvant, and 2-phenoxyethanol and formaldehyde preservatives in Medium 199 Hanks water for injection supplemented with polysorbate 80 [30].…”

Section: Avaxim® 80u Pediatric (Inactivated Hav Vaccine)mentioning

confidence: 99%

Clinical experience with the inactivated hepatitis A vaccine, Avaxim 80U Pediatric

Bravo

Mege

Vigne

et al. 2019

Expert Review of Vaccines

View full text Add to dashboard Cite

Introduction: Hepatitis A, caused by hepatitis A virus (HAV), is primarily transmitted via the fecal/oral route either through ingestion of contaminated food and water or through direct contact with an infectious person. Prevalence of hepatitis A is strongly correlated with socioeconomic factors, decreasing with increased socioeconomic development, access to clean water and sanitation. Vaccination against HAV should be part of a comprehensive plan for the prevention and control of viral hepatitis, either as part of regular childhood immunization programs or with other recommended vaccines for travelers. Areas covered: We present here evidence for the immunogenicity and safety of an inactivated HAV pediatric vaccine (Avaxim® 80U Pediatric, Sanofi Pasteur), indicated for use in children aged 12 months to 15 years. Data evaluated are from trials undertaken during the clinical development of this vaccine, a systematic literature review and post-market pharmacovigilance. Expert opinion: The pediatric HAV vaccine is highly immunogenic and generates long-lasting protection against hepatitis A disease in children. The safety and immunogenicity data presented in this review suggest that the pediatric HAV vaccine is a valuable option in the prevention of HAV infection in children in many areas of the world where the disease remains a healthcare issue.

show abstract

“…[2][3][4][5][6][7][8][9][10] In neonates, fecal excretion of HAV RNA may continue for as long as 6 Sensitivity of RT-PCR. Substances normally found in stool can inhibit the PCR reaction.…”

Section: Resultsmentioning

confidence: 99%

“…aminase (ALT) levels. [2][3][4][5] Fecal HAV antigen is detected for a Reverse transcription and PCR were carried out as described preslightly longer period during the course of hepatitis A by viously. 16 In brief, complementary DNA was synthesized with an radio-or enzyme-immunoassay than by immunoelectron miexternal antisense primer (A3; AGCATGGAGCTGTAGGAGTC) in croscopy.…”

Section: In Hepatitis a Virus (Hav) Infection Fecal Excretion Ofmentioning

confidence: 99%

Prolonged Fecal Excretion of Hepatitis A Virus in Adult Patients With Hepatitis A As Determined by Polymerase Chain Reaction

et al. 1996

View full text Add to dashboard Cite

the most sensitive method for the detection of nucleic acids. 14 In hepatitis A virus (HAV) infection, fecal excretion ofA recent report on an outbreak of hepatitis A in a neonatal the virus has been reported to cease shortly after sympintensive care unit reported the occurrence of prolonged extoms occur. Although there have been several reports cretion of HAV RNA in stool (as long as 6 months) much on detection of HAV in feces using polymerase chain longer than previously reported. 15 However, neonates may reaction (PCR), the duration of fecal HAV shedding in excrete HAV in stool for longer than adults because of their human adult hepatitis A has not been well described. In underdeveloped immunity.15 the present study, we applied the reverse-transcription In the present study, we determined HAV RNA in stools (RT)-PCR system to the detection of fecal HAV RNA in from adult patients using the two-stage reverse-transcription 10 patients with sporadic hepatitis A. The viral genomic (RT)-PCR method 16 and found that fecal shedding of HAV RNA was detected in the stools from five patients after continued for up to 3 months after onset of illness, and even the onset of clinical symptoms. All stool samples colafter the normalization of the serum ALT levels. ied by several methods. Immunoelectron microscopy has dis-sera as described previously.16 RNA pellets from 100 mL of sera were closed that HAV antigen is detectable in the stool before the dissolved in 25 mL of distilled water and subjected to PCR. Stool development of jaundice and peaking of serum alanine trans-RNA was extracted by the same method from 400 mL of 10% stool suspension in phosphate-buffered saline (pH 7.4).aminase (ALT) levels. Taq under the same conditions as used for the first amplification.Address reprint requests to: Kazuhiko Koike, M.D., First Department of Internal MediAliquots of the resulting samples were electrophoresed in 6% polycine,

show abstract

Hepatitis A-virus particles in stools of patients from a natural hepatitis outbreak in Germany

Cited by 26 publications

References 11 publications

Hepatitis A Virus Inhibits Cellular Antiviral Defense Mechanisms Induced by Double-Stranded RNA

Hepatitis A Virus Inhibits Cellular Antiviral Defense Mechanisms Induced by Double-Stranded RNA

Clinical experience with the inactivated hepatitis A vaccine, Avaxim 80U Pediatric

Prolonged Fecal Excretion of Hepatitis A Virus in Adult Patients With Hepatitis A As Determined by Polymerase Chain Reaction

Contact Info

Product

Resources

About