Hepatic Iron Overload Associated With a Decreased Serum Ceruloplasmin Level in a Novel Clinical Type of Aceruloplasminemia

Kono, Satoshi; Suzuki, Hitoshi; Takahashi, Kazuo; Takahashi, Yoshitomo; Shirakawa, Kentaro; Murakawa, Yohko; Yamaguchi, Shûhei; Miyajima, Hiroaki

doi:10.1053/j.gastro.2006.04.017

Cited by 55 publications

(29 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The few disease-associated mutants that have been characterized up to now invariably lack ferroxidase activity and fall into one of two categories as follows: truncated mutants are generally retained in the ER and cause ER-associated stress and activation of the "unfolded protein stress response" (21, 22); missense mutants display a folding defect that leads to retention in the ER (I9F and P177R) or they are secreted as apoproteins (G631R and G969S). Residues Gly-631 and Gly-969 are close to type 1 copper sites in domains 4 and 6, and their substitution introduces a structural defect that makes the protein unable to bind copper, as also demonstrated by the finding that it cannot be reconstituted by copper in vitro (11,12). Apo-Cp is unstable, and it is degraded in serum with a half-life of hours compared with days for the holo-protein (23), explaining the failure to detect Cp in the serum of patients.…”

Section: Discussionmentioning

confidence: 96%

“…Semiquantitative RT-PCR was carried out to assess mRNA levels for both endogenous Fpn and recombinant Fpn-GFP. Total RNA was extracted with TRIzol (Invitrogen) 24 h post-transfection and reverse-transcribed into cDNA using Moloney murine leukemia virus reverse transcriptase and oligo(dT) [12][13][14][15][16][17][18] (Invitrogen). Transcripts were amplified using the following specific primers: mFPN_for, ttgtggtcctgatgaaaaag, and GFP_rev, atgaacttcagggtcagctt (for recombinant Fpn-GFP); and rFPN_for, aatgttgtcaataccgtcca, and rFPN_rev, accatgatgaaatgcagaag (for rat Fpn).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Dominant Mutants of Ceruloplasmin Impair the Copper Loading Machinery in Aceruloplasminemia

Patti

Maio

Rizzo

et al. 2009

Journal of Biological Chemistry

View full text Add to dashboard Cite

The multicopper oxidase ceruloplasmin plays a key role in iron homeostasis, and its ferroxidase activity is required to stabilize cell surface ferroportin, the only known mammalian iron exporter. Missense mutations causing the rare autosomal neurodegenerative disease aceruloplasminemia were investigated by testing their ability to prevent ferroportin degradation in rat glioma C6 cells silenced for endogenous ceruloplasmin. Most of the mutants did not complement (i.e. did not stabilize ferroportin) because of the irreversible loss of copper binding ability. Mutant R701W, which was found in a heterozygous very young patient with severe neurological problems, was unable to complement per se but did so in the presence of copper-glutathione or when the yeast copper ATPase Ccc2p was co-expressed, indicating that the protein was structurally able to bind copper but that metal loading involving the mammalian copper ATPase ATP7B was impaired. Notably, R701W exerted a dominant negative effect on wild type, and it induced the subcellular relocalization of ATP7B. Our results constitute the first evidence of "functional silencing" of ATP7B as a novel molecular defect in aceruloplasminemia. The possibility to reverse the deleterious effects of some aceruloplasminemia mutations may disclose new possible therapeutic strategies.

show abstract

Section: Discussionmentioning

confidence: 96%

Section: Methodsmentioning

confidence: 99%

Dominant Mutants of Ceruloplasmin Impair the Copper Loading Machinery in Aceruloplasminemia

Patti

Maio

Rizzo

et al. 2009

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…During CPB, we have documented a 40% decrease in ceruloplasmin levels. Although levels of ceruloplasmin have not been extensively studied in cardiac surgery, decreased serum levels have been associated with hepatic iron overload (18). Additionally, ceruloplasmin has been shown to be essential for iron homeostasis and neuronal survival (19).…”

Section: Discussionmentioning

confidence: 99%

Plasma Biomarkers in Pediatric Patients Undergoing Cardiopulmonary Bypass

et al. 2008

View full text Add to dashboard Cite

ABSTRACT:It is critical to identify at-risk patients and minimize the deleterious effects of cardiopulmonary bypass (CPB) procedures in pediatric populations. The present study screened the plasma proteome of pediatric patients undergoing CPB procedures to identify potential clinical biomarkers related to tissue damage, inflammation, or other pathologies. Blood samples were collected at five different time points from 10 children undergoing a CPB procedure. Plasma was isolated and analyzed using two-dimensional differential in-gel electrophoresis and matrix-assisted laser desorption ionization time of flight mass spectrometry. Levels of differentially regulated proteins identified by two-dimensional differential in-gel electrophoresis, and related proteins were then measured in all time points and patients. As well, associated small molecules and ions were measured. The present study identified 13 proteins and protein isoforms altered in expression, including hemopexin, ceruloplasmin, inter-alpha inhibitor H4, and alpha-2-macroglobulin. Immunoblot analysis revealed significant decreases in each of these proteins during the CPB procedure. Significant changes in the levels of copper, iron, Hb, epinephrine, norepinephrine, and serotonin were observed. The potential markers of pathology (inflammation, oxidative stress) identified during this preliminary study may illuminate opportunities for preventative measures and/or treatments during and following CPB procedures in pediatric patients. (Pediatr Res 63: 638-644, 2008)A lthough cardiopulmonary bypass (CPB) methods are well optimized and mortality rates from pediatric CPB continue to decrease (1,2), surgery-related pathologies are still a major concern. In fact, changes have been observed in levels of cytokines (3), and CD antigens (4) in the blood following CPB procedures. Changes in such molecules may reflect tissue damage, inflammation, and other pathologies that could affect both the long-and short-term patient outcome. These markers of pathology are risk factors for in-hospital or post-discharge morbidity and mortality in pediatric CPB patients (5,6). A more complete catalog of the circulating changes accompanying pediatric CPB surgeries may enable better prevention and treatment of complications.Although survival with good acute outcomes after surgery is increasingly likely with pediatric CPB procedures, neurodevelopmental complications such as lower intelligence, motor deficits, and impaired language skills remain a concern (7). In addition, a higher incidence of behavioral and attention problems have been reported in these patients (8,9). Although the cause of such deficits has not been shown to result from the CPB procedure itself, it is important to identify the potential long-term effects of pediatric cardiac surgery on development.Previous studies by our laboratory have used proteomic techniques-specifically two-dimensional differential in-gel electrophoresis (2-DIGE)-to examine the proteomic profile of various tissues and body fluids (10 -12). We have p...

show abstract

“…Hereditary aceruloplasminemia� � Hereditary aceruloplasminemia [17,18] is an exceptionnal disease transmitted as a recessive trait. Under the lens, iron is found predominantly in parenchymal cells.…”

Section: Nonhemochromatotic Genetic Iron Overloadmentioning

confidence: 99%