Heme oxygenase-1 gene promoter polymorphism is associated with reduced incidence of acute chest syndrome among children with sickle cell disease

Abstract

Sickle cell disease is a common hemolytic disorder with a broad range of complications, including vaso-occlusive episodes, acute chest syndrome (ACS), pain, and stroke. Heme oxygenase-1 (gene HMOX1; protein HO-1) is the inducible, rate-limiting enzyme in the catabolism of heme and might attenuate the severity of outcomes from vaso-occlusive and hemolytic crises. A (GT) n dinucleotide repeat located in the promoter region of the HMOX1 gene is highly polymorphic, with long repeat lengths linked to decreased activity and inducibility. We examined this polymorphism to test the hypothesis that short alleles are associated with a decreased risk of adverse outcomes (hospitalization for pain or ACS) among a cohort of 942 children with sickle cell disease. Allele lengths varied from 13 to 45 repeats and showed a trimodal distribution. Compared with children with longer allele lengths, children with 2 shorter alleles (4%; < 25 repeats) had lower rates of hospitalization for ACS (incidence rate ratio 0.28, 95%

Genetic variants and cell-free hemoglobin processing in sickle cell nephropathy

“…69 In children with SCD, shorter HMOX1 GT repeats were associated with lower rates of hospitalization for acute chest syndrome. 45 Consistent with the shorter GT-tandem repeat length polymorphism having a protective effect in SCD, 45 we observed increased eGFR with the shorter allele. We did not observe an association between the HMOX1 rs743811 or the GT-tandem repeat variant with HMOX1 expression in peripheral blood mononuclear cells.…”

“…Allele dosages were associated with hemoglobinuria and markers of kidney disease in the UIC cohort and validated in the Walk-PHaSST cohort. The multi-allele polymorphism of GTtandem repeats in the promoter region of HMOX1, which may affect heme oxygenase activity 44 and clinical outcome in SCD patients, 45 was also determined in the SCD patients from the UIC cohort. The 5'-flanking region containing (GT)n repeats of HMOX1 was amplified by PCR with a 5-carboxyfluorescein-labeled forward primer (AGAGCCTGCAGCTTCTCAGA) and standard reverse primer (ACAAAGTCTGGCCATAGGAC), as described previously.…”

Intravascular hemolysis and the pathophysiology of sickle cell disease

“…New understanding of the role of red cell hemolysis products, redox disequilibrium, and eDAMPs in the end-organ injury observed in SCD provides a pathway for identifying counterregulatory signaling pathways that might dampen sterile inflammation and oxidative stress, e.g., upregulation and protective polymorphisms in the heme oxygenase-1 enzyme (134,145). Upstream activation of the KEAP1/NRF2 redox sensing transcription pathway, a central counterregulatory program that protects against oxidative and hemolytic stress, is being actively investigated as a therapy for SCD ( 147).…”

Genetics of Sickle Cell-Associated Cardiovascular Disease: An Expert Review with Lessons Learned in Africa

“…Heme oxygenase-1 (HO-1), an inducible isoform of HO, plays a vital role in the amelioration of inflammation and vaso-occlusion commonly seen in SCD (Bean et al, 2012;Belcher et al, 2006). Substantial induction of the HMOX1 gene in response to oxidative stress has been demonstrated in the kidneys of transgenic SCD mice (Nath et al, 2001).…”

“…Another SNP in HMOX1, rs743811, has been associated with chronic kidney disease and ESRD in a group of African-American SCD patients (Saraf et al, 2015) ( Table 2). HMOX1 therefore plays a functional role in modulating the development of kidney disease in SCD patients through insufficient protection from hemoglobinmediated toxicity (Bean et al, 2012).…”