HDAC6 Inhibition Corrects Electrophysiological and Axonal Transport Deficits in a Human Stem Cell‐Based Model of Charcot‐Marie‐Tooth Disease (Type 2D)

Abstract

Charcot‐Marie‐Tooth disease type 2D (CMT2D), is a hereditary peripheral neuropathy caused by mutations in the gene encoding glycyl‐tRNA synthetase (GARS1). Here, human induced pluripotent stem cell (hiPSC)‐based models of CMT2D bearing mutations in GARS1 and their use for the identification of predictive biomarkers amenable to therapeutic efficacy screening is described. Cultures containing spinal cord motor neurons generated from this line exhibit network activity marked by significant deficiencies in spontaneous action potential firing and burst fire behavior. This result matches clinical data collected from a patient bearing a GARS1P724H mutation and is coupled with significant decreases in acetylated α‐tubulin levels and mitochondrial movement within axons. Treatment with histone deacetylase 6 inhibitors, tubastatin A and CKD504, improves mitochondrial movement and α‐tubulin acetylation in these cells. Furthermore, CKD504 treatment enhances population‐level electrophysiological activity, highlighting its potential as an effective treatment for CMT2D.

Role of Selective Histone Deacetylase 6 Inhibitor ACY-1215 in Cancer and Other Human Diseases

“…What’s more, ACY-1215 ameliorates mitochondrial transport deficits by increasing tubulin acetylation, which in turn rescue axon transport deficits and then reverse motor and sensory deficits in a mouse model for mutant “small heat shock protein B1”-induced CMT2 at both behavioral and electrophysiological levels ( Benoy et al, 2017 ). The effect of ACY-1215 on CMT has also been demonstrated in CKD-504 ( Ha et al, 2020 ; Smith et al, 2022 ).…”

“…However, except for ACY-1215, the present application range of other HDAC6 inhibitors is limited. Studies on ACY-241 ( Ray et al, 2018 ; Cosenza et al, 2020 ; Awad et al, 2021 ; Park et al, 2021 ) and KA2507 ( Tsimberidou et al, 2021 ) mainly focused on tumors, CKD-504 ( Choi et al, 2020 ; Ha et al, 2020 ; Jeong et al, 2022 ; Smith et al, 2022 ) focused on neurological diseases, and CKD-506 ( Choi et al, 2018 ; Park et al, 2020 ; Bae et al, 2021 ) focused on inflammatory diseases. Although ACY-241 and KA2507 show higher selectivity over ACY-1215 on HDAC6, its studies on other diseases needs further research ( Table 3 ).…”

Therapeutic Potential of CKD-504, a Novel Selective Histone Deacetylase 6 Inhibitor, in a Zebrafish Model of Neuromuscular Junction Disorders

“…Previous reports have shown that HDAC6 inhibition in neurodegenerative diseases leads to an increase in microtubule acetylation, which improves neurite growth, axonal transportation, neuroprotection, and mitochondrial movements ( Simoes-Pires et al, 2013 ; Wenzel et al, 2019 ). It is noteworthy that HDAC6 inhibition was involved not only in enhancing NMJ stability but also in the clustering of AChRs on the postsynaptic side of the NMJ ( Osseni et al, 2020 ; Smith et al, 2022 ). Correspondingly, our data clearly showed that gars depletion-induced NMJ disruption was restored following treatment with HDAC6 inhibitors ( Figs.…”

High-throughput, real-time monitoring of engineered skeletal muscle function using magnetic sensing

“…Working with the University of Washington’s Institute for Stem Cell and Regenerative Medicine Ellison Stem Cell Core, dystrophin-null genotypes were engineered into the UC3-4 normal line using methods described previously. 25 , 26 Cas9 guide RNAs (gRNA) targeting the DMD locus were designed using CRISPoR. Three gRNA were chosen, targeting intron 44 (AAAAACTGGAGCTAACCGAG), intron 45 (ATATACTTGTGGCTAGTTAG), and exon 54 (TGGCCAAAGACCTCCGCCAG) ( Supplemental Figure S1A ).…”