GTPase dependent recruitment of Grif-1 by Miro1 regulates mitochondrial trafficking in hippocampal neurons

MacAskill, Andrew F.; Brickley, Kieran; Stephenson, F. Anne; Kittler, Josef T.

doi:10.1016/j.mcn.2008.10.016

Cited by 152 publications

(223 citation statements)

References 45 publications

Supporting

Mentioning

216

Contrasting

Unclassified

Order By: Relevance

“…The sequence of the selected shRNAi-Alex3 was 5′-CGCGTCCCCGGCTTTAATTGT CCTAAATTTCAAGAGAATTTAGGACAATTAAAGCCTTTTTGGAAAT-3′; and the scrambled shRNAi-control 5′-CGCGTCCCCGCAGCTTTAATTGCTC TGGGTAATAATATTCATATTACCCAGAGCAATTAAAGCTGCTTTTTGG AAAT-3′. The expression vectors Miro1-myc, Miro2-myc, Miro1∆EF-myc, KIF1C-myc and Trak2-myc were as previously described 10,38 . Miro1 shRNAi (V2MM_72258, TGCTGTTGACAGTGAGCGCCCTGATTGCACTACTGAATTA TAGTGAAGCCACAGATGTA TAATTCAGTAGTGCAATCAGGATGCCTACT GCCTCGGA; and a control scrambled sequence) was provided by Josef Kittler (UCL, London).…”

Section: Discussionmentioning

confidence: 99%

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

et al. 2012

View full text Add to dashboard Cite

Brain function requires neuronal activity-dependent energy consumption. neuronal energy supply is controlled by molecular mechanisms that regulate mitochondrial dynamics, including Kinesin motors and mitofusins, miro1-2 and Trak2 proteins. Here we show a new protein family that localizes to the mitochondria and controls mitochondrial dynamics. This family of proteins is encoded by an array of armadillo (Arm) repeat-containing genes located on the X chromosome. The Armcx cluster is unique to Eutherian mammals and evolved from a single ancestor gene (Armc10). We show that these genes are highly expressed in the developing and adult nervous system. Furthermore, we demonstrate that Armcx3 expression levels regulate mitochondrial dynamics and trafficking in neurons, and that Alex3 interacts with the Kinesin/miro/Trak2 complex in a Ca 2 + -dependent manner. our data provide evidence of a new Eutherian-specific family of mitochondrial proteins that controls mitochondrial dynamics and indicate that this key process is differentially regulated in the brain of higher vertebrates.

show abstract

Section: Discussionmentioning

confidence: 99%

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

et al. 2012

View full text Add to dashboard Cite

show abstract

“…However, we have previously described the distribution of TRAK2 using specific anti-TRAK2 antibodies in neuronal cultures prepared from hippocampi of E18 rats at 14 DIV (equivalent to 11 DIV for P0 cultures as used here; Ref. 18). Anti-TRAK2 immunoreactivity was present throughout all neuronal processes, and ϳ50% was co-distributed with mitochondria (18).…”

Section: Discussionmentioning

confidence: 99%

“…Miro1 and Miro2 co-distribute and co-immunoprecipitate with Milton, TRAK1, or TRAK2 following overexpression in mammalian cells (15,16,17). Furthermore, Miro1 co-immunoprecipitates with TRAK2 from brain extracts (18). Overexpression of fluorescently tagged TRAK2 or Miro1 constructs in hippocampal neurons results in an increase in the number of mitochondria transported to the periphery of hippocampal neurons (18).…”

mentioning

confidence: 99%

“…Furthermore, Miro1 co-immunoprecipitates with TRAK2 from brain extracts (18). Overexpression of fluorescently tagged TRAK2 or Miro1 constructs in hippocampal neurons results in an increase in the number of mitochondria transported to the periphery of hippocampal neurons (18). Furthermore, expression of the Miro1 binding domain of TRAK2, uncoupling Miro1 from TRAK2, results in prevention of this induced redistribution of mitochondria into the periphery (18).…”

mentioning

confidence: 99%

“…Overexpression of fluorescently tagged TRAK2 or Miro1 constructs in hippocampal neurons results in an increase in the number of mitochondria transported to the periphery of hippocampal neurons (18). Furthermore, expression of the Miro1 binding domain of TRAK2, uncoupling Miro1 from TRAK2, results in prevention of this induced redistribution of mitochondria into the periphery (18). Finally, in dendrites of hippocampal neurons, overexpression of Miro1 results in a percent increase in the number of moving mitochondria.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Trafficking Kinesin Protein (TRAK)-mediated Transport of Mitochondria in Axons of Hippocampal Neurons

Brickley

Stephenson

2011

Journal of Biological Chemistry

Self Cite

156

127

View full text Add to dashboard Cite

In neurons, the proper distribution of mitochondria is essential because of a requirement for high energy and calcium buffering during synaptic neurotransmission. The efficient, regulated transport of mitochondria along axons to synapses is therefore crucial for maintaining function. The trafficking kinesin protein (TRAK)/Milton family of proteins comprises kinesin adaptors that have been implicated in the neuronal trafficking of mitochondria via their association with the mitochondrial protein Miro and kinesin motors. In this study, we used gene silencing by targeted shRNAi and dominant negative approaches in conjunction with live imaging to investigate the contribution of endogenous TRAKs, TRAK1 and TRAK2, to the transport of mitochondria in axons of hippocampal pyramidal neurons. We report that both strategies resulted in impairing mitochondrial mobility in axonal processes. Differences were apparent in terms of the contribution of TRAK1 and TRAK2 to this transport because knockdown of TRAK1 but not TRAK2 impaired mitochondrial mobility, yet both TRAK1 and TRAK2 were shown to rescue transport impaired by TRAK1 gene knock-out. Thus, we demonstrate for the first time the pivotal contribution of the endogenous TRAK family of kinesin adaptors to the regulation of mitochondrial mobility.Mitochondria serve several functions in cells. These functions include the generation of energy in the form of ATP, the buffering of calcium ions, and the regulation of apoptosis. Thus, within cells, mitochondria need to move so they can respond to local needs. In the nervous system, mitochondria and mitochondrial transport are particularly important because of a requirement for high energy and calcium buffering during synaptic neurotransmission. The mitochondrial population in neurons is therefore highly mobile, and the dynamics of their transport are tightly regulated to satisfy these demands. Mitochondria can move in both anterograde and retrograde directions, utilizing motor proteins and the microtubule network (for reviews, see Refs. 1-3). Furthermore, they can be anchored at defined sites; one example is mitochondrial immobilization by a Ca 2ϩ -dependent mechanism at synaptic sites (4 -7). Recently, there has been significant progress in the understanding of mitochondrial transport processes with the identification of several proteins implicated in their trafficking mechanisms.The best characterized of these include the trafficking kinesin protein (TRAK) 2 /Milton family of kinesin adaptors; Miro1 and Miro2, atypical Rho GTPases that reside in the mitochondrial outer membrane that are purported receptors for TRAKs; syntabulin, also a kinesin adaptor protein; and syntaphilin, an axonal mitochondrial docking protein (for reviews, see Refs. 3 and 8).There are two mammalian TRAKs, TRAK1 and TRAK2, that share ϳ58% amino acid homology (9, 10). The TRAKs, like their Drosophila orthologue Milton (11), have been shown to function as kinesin adaptors linking kinesin heavy chain (KHC) to mitochondria by their association with Miro1/2. T...

show abstract

Quantum Dot Labeling for Assessment of Intracellular Trafficking of Therapeutically Active Molecules

Burgess

Kapoor

2010

Organelle‐Specific Pharmaceutical Nanotechnology

View full text Add to dashboard Cite

GTPase dependent recruitment of Grif-1 by Miro1 regulates mitochondrial trafficking in hippocampal neurons

Cited by 152 publications

References 45 publications

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2

Trafficking Kinesin Protein (TRAK)-mediated Transport of Mitochondria in Axons of Hippocampal Neurons

Quantum Dot Labeling for Assessment of Intracellular Trafficking of Therapeutically Active Molecules

Contact Info

Product

Resources

About