GT198 Splice Variants Display Dominant-Negative Activities and Are Induced by Inactivating Mutations

Abstract

Alternative pre-mRNA splicing yields functionally distinct splice variants in regulating normal cell differentiation as well as cancer development. The putative tumor suppressor gene GT198 (PSMC3IP), encoding a protein also known as TBPIP and Hop2, has been shown to regulate steroid hormone receptor-mediated transcription and to stimulate homologous recombination in DNA repair. Here, we have identified 6 distinct GT198 splice variant transcripts generated by alternative promoter usage or alternative splicing. Various splice variant transcripts preserve a common open reading frame, which encodes the DNA binding domain of GT198. The splice variants act as dominant negatives to counteract wild-type GT198 activity in transcription and to abolish Rad51 foci formation during radiation-induced DNA damage. In fallopian tube cancer, we have identified 44 point mutations in GT198 clustered in 2 mutation hotspot sequences. The mutation hotspots coincide with the regulatory sequences responsible for alternative splicing, strongly supporting that imbalanced alternative splicing is a selected consequence in cancer. In addition, splice variant-associated cytoplasmic expression is found in tumors carrying germline or somatic GT198 mutations. An altered alternative splicing pattern with increased variants is also present in lymphoblastoid cells derived from familial breast cancer patients carrying GT198 germline mutations. Furthermore, GT198 and its variant are reciprocally expressed during mouse stem cell differentiation. The constitutive expression of the GT198 variant but not the wild type induces tumor growth in nude mice. Our results collectively suggest that mutations in the GT198 gene deregulate alternative splicing. Defective alternative splicing promotes antagonizing variants and in turn induces a loss of the wild type in tumorigenesis. The study highlights the role of alternative splicing in tumor suppressor gene inactivation.

Human Ovarian Cancer Stroma Contains Luteinized Theca Cells Harboring Tumor Suppressor Gene GT198 Mutations

“…We have recently identified GT198 germ line mutations in familial and early onset breast and ovarian cancers (25) and prevalent GT198 somatic mutations in sporadic fallopian tube cancers (26). Loss of GT198 function is associated with its mutations (26). The collective existing evidence supports a functional role of GT198 in ovary and signifies the potential of its mutations in studying ovarian cancer.…”

“…The overall protein expression pattern in mouse is remarkably similar between GT198 and BRCA1 or BRCA2 (30). Wild type GT198 is a nuclear protein and the expression becomes cytoplasmic when the GT198 gene is mutated (26). Using cytoplasmic GT198 as a marker, we screened 246 cases of human ovarian cancer by immunohistochemistry.…”

“…The cloned CYP17 promoter was verified by restriction mapping and sequencing analysis. 293 cells were transfected in triplicate in 24-well plates using CYP17-luciferase reporter (100 ng), and various amounts of plasmids (0, 50, 100, 200 ng) of wild type GT198 (amino acids 1-217), GT198 mutant protein (amino acids 126 -217) containing the DNA-binding domain, or various amounts of GT198 siRNA gugagugaugcugaccuuca (0, 25, 50, and 100 M), which is against GT198 exon 4 and was previously shown to inhibit wild type mRNA (26). After transfection, the cells were incubated for 48 h before harvest.…”

“…Genomic DNA from dissected cells (ϳ50 -200 cells) was isolated by DNeasy tissue kit reagents using 1:10 scaling down quantity (Qiagen). DNA samples were sequence-analyzed using PfuTurbo DNA polymerase (Stratagene) with repeats in two previously identified mutation hot spots (26), at 5Ј-UTR to intron 1 (c.Ϫ109C to c.34 ϩ 69C) and at the exon 4-intron 4 junction (c.265C to c.337 ϩ 116T) because of the limited amount of DNA. The primers are ggggtcgctttgctcctccggaa, ctacggagagaaaggcagggga, gtgagtgatgctgaccttcaagtc, and tacacaaaagccgttagttatcct.…”

“…A homozygous germ line deletion mutation in GT198 is identified in familial ovarian dysgenesis disease (24). We have recently identified GT198 germ line mutations in familial and early onset breast and ovarian cancers (25) and prevalent GT198 somatic mutations in sporadic fallopian tube cancers (26). Loss of GT198 function is associated with its mutations (26).…”