Gsx2 but not Gsx1 is necessary for early forebrain patterning and long-term survival in zebrafish

Abstract

Central nervous system (CNS) development is regulated by regionally expressed transcription factors that impart initial cell identity, connectivity, and function to neural circuits through complex molecular genetic cascades. genomic screen homeobox 1 and 2 (gsx1 and gsx2) encode homeobox transcription factors expressed in the developing CNS in multiple vertebrates examined to date. However, we have limited knowledge of the expression of these transcription factors and the gene networks that they regulate across developing brain regions in zebrafish. The objective of this study was to comprehensively examine gsx1 and gsx2 expression throughout neurodevelopment and characterize gsx1 and gsx2 mutants to study the essential roles of these closely related transcription factors. Using RT-PCR, whole-mount in situ hybridization (WISH), and fluorescence in situ hybridization, we examine gsx1 and gsx2 expression from early embryonic to late larval stages. gsx1 is expressed initially in the hindbrain and diencephalon and later in the optic tectum, pretectum, and cerebellar plate. Comparatively, gsx2 is expressed in the early telencephalon and later in the pallium and olfactory bulb. gsx1 and gsx2 are regionally co-expressed in the hypothalamus, preoptic area, and hindbrain, however rarely co-localize in the same cells. To identify forebrain target genes, we utilize mutants made with Transcription activator-like effector nucleases (TALEN). gsx1 mutant zebrafish exhibit stunted growth, however, they survive through adulthood and are fertile. gsx2 mutant zebrafish experience swim bladder inflation failure that prevents survival past larval stage. Using WISH and RT-qPCR we demonstrate altered expression of genes including, distal-less homeobox genes and forkhead box gene foxp2. This work provides novel tools with which other target genes and functions of Gsx1 and Gsx2 can be characterized across the CNS to better understand the unique and overlapping roles of these highly conserved transcription factors.

Environmental and Molecular Modulation of Motor Individuality in Larval Zebrafish

“…Transgenic lines used were enhancer trap Tg(y279-Gal4) ( Marquart et al, 2015 ) and Tg(UAS:Kaede)s1999t ( Davison et al, 2007 ). Mutant line used was gsx2 Δ13 a ( Coltogirone et al, 2021 ).…”

“…For gsx2 experiments, larvae were housed individually following behavior testing for post hoc genotyping. Genotyping was performed as previously described ( Coltogirone et al, 2021 ). In brief, genotypes were confirmed using PCR spanning the deletion: gsx2 (primers: 5′TGCGTATCCTCACACATCCA, 5′TGTCCAGGGTGCGCTAAC; 134 bp wildtype, 121 bp mutant, and 134/121 bp heterozygous).…”

“…In brief, genotypes were confirmed using PCR spanning the deletion: gsx2 (primers: 5′TGCGTATCCTCACACATCCA, 5′TGTCCAGGGTGCGCTAAC; 134 bp wildtype, 121 bp mutant, and 134/121 bp heterozygous). Previous reports describe that gsx2 mutants have reduced swim bladder inflation ( Coltogirone et al, 2021 ), which was minimized by raising larvae in shallow water dishes. Only larvae with normal swim bladder inflation and balance were used for experiments.…”

“…For gsx2 experiments, larvae were housed individually following behavior testing for post hoc genotyping. Genotyping was performed as previously described (Coltogirone et al, 2021).…”

Environmental and molecular modulation of motor individuality in larval zebrafish

“…For gsx2 experiments, larvae were housed individually following behavior testing for posthoc genotyping. Genotyping was performed as previously described (Coltogirone et al, 2021). In brief, genotypes were confirmed using PCR spanning the deletion: gsx2 (primers: 5'TGCGTATCCTCACACATCCA, 5'TGTCCAGGGTGCGCTAAC; 134 bp wildtype, 121 bp mutant, and 134/121 bp heterozygous).…”