GsSKP21, a Glycine soja S-phase kinase-associated protein, mediates the regulation of plant alkaline tolerance and ABA sensitivity

Abstract

Plant SKP1-like family proteins, components of the SCF complex E3 ligases, are involved in the regulation of plant development and stress responses. Little is known about the precise function of SKP genes in plant responses to environmental stresses. GsSKP21 was initially identified as a potential stress-responsive gene based on the transcriptome sequencing of Glycine soja. In this study, we found that GsSKP21 protein contains highly conserved SKP domains in its N terminus and an extra unidentified domain in its C terminus. The transcript abundance of GsSKP21, detected by quantitative real-time PCR, was induced under the treatment of alkali and salt stresses. Overexpression of GsSKP21 in Arabidopsis dramatically increased plant tolerance to alkali stress. Furthermore, we found that overexpression of GsSKP21 resulted in decreased ABA sensitivity during both the seed germination and early seedling growth stages. GsSKP21 mediated ABA signaling by altering the expression levels of the ABA signaling-related and ABA-induced genes. We also investigated the tissue expression specificity and subcellular localization of GsSKP21. These results suggest that GsSKP21 is important for plant tolerance to alkali stress and plays a critical regulatory role in the ABA-mediated stress response.

GsSLAH3, a Glycine soja slow type anion channel homolog, positively modulates plant bicarbonate stress tolerance

“…The area of saline–alkali soils covering western Songnen Plain has been expanding. Much of this soil contains alkaline salts like Na 2 CO 3 and NaHCO 3 , severely threatening crop growth and productivity (Liu et al ). With the development of functional genomics and bioengineering technologies, researchers have attempted to exploit the alkalized soil.…”

“…To overexpress GsSLAH3 in Arabidopsis, the coding region of GsSLAH3 was cloned (forward: 5′‐AGGCCCGGGATGGAAAACAACCTTAACCGT‐3′ and reverse: 5′‐TCGTCTAGATCATGGCTCCCAAGTCTTAAATGG‐3′) and inserted (SmaI and XbaI) into pCAMBIA2300 (Liu et al ). The recombinant vector was transformed into Agrobacterium tumefaciens strain LBA4404.…”

iTRAQ-Based Analysis of Proteins Co-Regulated by Brassinosteroids and Gibberellins in Rice Embryos during Seed Germination

“…Another study also demonstrated that transcript abundance of GsSKP21 was induced under the treatment of alkali and salt stresses in Glycine soja . Overexpression of GsSKP21 in Arabidopsis results in decreased ABA sensitivity and promoted seed germination [ 49 ]. Moreover, the accumulation of glutamate decarboxylase (GAD) and alcohol dehydrogenase (ADH) are also promoted in both sd1 mutant and BRZ-treated Nip ( Table 2 ).…”

Arabidopsis SKP1-like protein13 (ASK13) positively regulates seed germination and seedling growth under abiotic stress

“…ASK1 has further been found to be involved in meiotic events and flower development ( Yang et al , 1999 , 2006 ; Wang and Yang, 2006 ; Lu et al , 2016 ). Recent studies have determined the roles of SKP proteins in abiotic stress tolerance in several plant species, including Paeonia suffruticosa , Triticum aestivum , and Glycine soja ( Li et al , 2012 ; Liu et al , 2015 ; Hao et al , 2017 ). Expression analysis of various ASK proteins in Arabidopsis has also suggested their participation in the seed germination processes ( Marrocco et al , 2003 , Zhao et al , 2003 ; Takahashi et al , 2004 ; Dezfulian et al , 2012 ; Kuroda et al , 2012 ).…”